RNA

RNA is an esoteric programming language based on real biological RNA structure. It was created in 2008 by Cyrus H. and first implemented in 2011.

Programs are written as sequences of codons — triplets of the nucleotide letters A, U, G, C — making source code look like actual RNA strands.

Language Basics

Storage Model

RNA provides three storage abstractions:

Name	Width	Internal type	Description
strg	8-bit	unsigned char	Index register used to manipulate ptr
ptr	32/64-bit	unsigned char *	Memory index storage, points into memory
memory	unbounded	unsigned char []	Serial byte storage, limited only by physical RAM

Execution

• Execution begins at the first Methionine codon (AUG). All codons before it are ignored.
• Execution ends at the first Termination codon (UAA, UAG, or UGA). All codons after it are ignored.
• Non-nucleotide characters (whitespace, digits, punctuation, etc.) are silently skipped by the parser, allowing inline comments.

Comments

Any character that is not one of A, U, G, C (or T for the DNA dialect) is treated as whitespace and ignored. This means any text not containing those five letters is effectively a comment. For example:

!! This is a comment — no A/U/G/C/T letters here
UGG ACA CCC  !! set mem[0] via input

Commands

There are 16 active instructions covering 49 codons. 5 additional amino-acid groups are reserved as No-Op.

Active Instructions

#	Amino acid	Codons	Operation	Description
1	Methionine (Met)	AUG	program entry	Program activation indicator
2	Termination (Ter)	UAA UAG UGA	program exit	Program termination indicator
3	Tryptophan	UGG	strg = 0	Reset index register
4	Lysine	AAA AAG	++strg	Increment index register
5	Asparagine	AAC AAU	--strg	Decrement index register
6	Alanine	GCA GCC GCG GCU	strg = *ptr	Read memory byte into strg
7	Threonine	ACA ACC ACG ACU	ptr = &memory[strg]	Reposition pointer
8	Proline	CCA CCC CCG CCU	scanf("%d", ptr)	Read decimal integer, store low 4 bits at *ptr
9	Leucine	CUA CUC CUG CUU	printf("%c", *ptr)	Output *ptr as ASCII (low 7 bits)
10	Arginine	AGA AGG CGA CGC CGG CGU	*ptr += memory[strg]	Addition
11	Serine	AGC AGU UCA UCC UCG UCU	*ptr *= memory[strg]	Multiplication
12	Glutamine	CAA CAG	*ptr -= memory[strg]	Subtraction
13	Histidine	CAC CAU	*ptr /= memory[strg]	Division
14	Glutamic acid	GAA GAG	*ptr = (*ptr == memory[strg]) ? 1 : 0	Equality test
15	Aspartic acid	GAC GAU	while (*ptr) {	Loop start. If *ptr == 0, skip to matching Tyrosine.
16	Tyrosine	UAC UAU	}	Loop end. Jump back to matching Aspartic acid.

Reserved Instructions (No-Op)

#	Amino acid	Codons
17	Cysteine	UGC UGU
18	Phenylalanine	UUC UUU
19	Isoleucine	AUA AUC AUU
20	Glycine	GGA GGC GGG GGU
21	Valine	GUA GUC GUG GUU

Codon Encoding

Each codon is 3 nucleotides. Internally, nucleotides are mapped to digits: A=1, U=2, G=3, C=4. Three nucleotides are combined as first×100 + second×10 + third×1.

For example, AUG = 1×100 + 2×10 + 3×1 = 123.

Examples

Hello World

Since Proline (scanf) can only read values 0–15, each output character must be decomposed into a product of two small factors plus an optional adjustment: value = a × b + c where a, b ∈ [1,15] and |c| ≤ 15.

Full RNA program (line form), 696 nucleotides:

AUGUGGACACCCAAAACACCCUGGACAAAAAGCCUAUGGACACCCAAAACACCCUGGACAAAAAGCAAAACACCCUGGACAAAA
AAAAGACUAUGGACACCCAAAACACCCUGGACAAAAAGCCUAUGGACACCCAAAACACCCUGGACAAAAAGCCUAUGGACACCC
AAAACACCCUGGACAAAAAGCAAAACACCCUGGACAAAAAAACAACUAUGGACACCCAAAACACCCUGGACAAAAAGCCUAUGG
ACACCCAAAACACCCUGGACAAAAAGCAAAACACCCUGGACAAAAAAACAACUAUGGACACCCAAAACACCCUGGACAAAAAGC
AAAACACCCUGGACAAAAAAACAACUAUGGACACCCAAAACACCCUGGACAAAAAGCAAAACACCCUGGACAAAAAAAAGACUA
UGGACACCCAAAACACCCUGGACAAAAAGCCUAUGGACACCCAAAACACCCUGGACAAAAAGCCUAUGGACACCCAAAACACCC
UGGACAAAAAGCCUAUAA

The companion input file provides the small integers that Proline reads:

6 12 10 10 1 9 12 9 12 8 14 1 4 8 8 11 1 8 14 1 8 14 2 9 12 10 10 3 11

Fibonacci Numbers

This program outputs the first 13 Fibonacci numbers (0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144) as raw bytes. It uses a loop with all four arithmetic operations.

AUGUGGACACCCAAAACACCCUGGAAAAAAAAAACACCCUGGAAAAAAAAAAAAAAAAAAACACCCUGGAAAAAAAAAACAG
ACUGGACACUAUGGAAAAAAAAAAAAACACAAUGGAGAAAAAGAUGGACACAAAAAAGAUGGAAAACACAAAAAAAAAAAAG
AUGGAAAAAAAAAACAAAAAAAAAACAAUACUAA

Companion inputs: 0 1 13 1

Dialect

DNA

The DNA dialect replaces U (Uracil) with T (Thymine). All instructions map one-to-one; converting an RNA program to DNA is a simple find-and-replace. For example, AUG becomes ATG, UAA becomes TAA.

Both the original C interpreter and the Python interpreter linked below support the DNA dialect natively.

Implementations

• Python interpreter — Full-featured, modular implementation with nested-loop support, DNA dialect compatibility, and example programs.
  • Repository: RNA on GitHub
• C reference implementation — Original C99 implementation by Cyrus H., compilable with GCC under macOS.