Examine individual changes
Jump to navigation
Jump to search
This page allows you to examine the variables generated by the Abuse Filter for an individual change.
Variables generated for this change
| Variable | Value |
|---|---|
Edit count of the user (user_editcount) | 0 |
Name of the user account (user_name) | 'RGSW' |
Age of the user account (user_age) | 526 |
Page ID (page_id) | 0 |
Page namespace (page_namespace) | 0 |
Page title (without namespace) (page_title) | 'Genetic' |
Full page title (page_prefixedtitle) | 'Genetic' |
Action (action) | 'edit' |
Edit summary/reason (summary) | '' |
Old content model (old_content_model) | '' |
New content model (new_content_model) | 'wikitext' |
Old page wikitext, before the edit (old_wikitext) | '' |
New page wikitext, after the edit (new_wikitext) | ''''Genetic''' (a.k.a. ''DNA'') is an [[esoteric programming language]] that allows only the four DNA-bases (T, C, G and A), whitespaces and newlines (carriage return or line feed).
==Examples==
===Hello world===
ACTCAAGACCGTACTCGACCCCGTACTCGATACCGTACTCGATACCGTACTCGATTCCGTACTAGAAACCGTACTCCACTCCGTACTCGATTCCGTACTCTAAGCCGTACTCGATACCGTACTCGACACCGTACTAGAACCCGTACTAAAGGCCGT' |
Unified diff of changes made by edit (edit_diff) | '@@ -1,0 +1,5 @@
+'''Genetic''' (a.k.a. ''DNA'') is an [[esoteric programming language]] that allows only the four DNA-bases (T, C, G and A), whitespaces and newlines (carriage return or line feed).
+
+==Examples==
+===Hello world===
+ ACTCAAGACCGTACTCGACCCCGTACTCGATACCGTACTCGATACCGTACTCGATTCCGTACTAGAAACCGTACTCCACTCCGTACTCGATTCCGTACTCTAAGCCGTACTCGATACCGTACTCGACACCGTACTAGAACCCGTACTAAAGGCCGT
' |
New page size (new_size) | 370 |
Old page size (old_size) | 0 |
Lines added in edit (added_lines) | [
0 => ''''Genetic''' (a.k.a. ''DNA'') is an [[esoteric programming language]] that allows only the four DNA-bases (T, C, G and A), whitespaces and newlines (carriage return or line feed).',
1 => '',
2 => '==Examples==',
3 => '===Hello world===',
4 => ' ACTCAAGACCGTACTCGACCCCGTACTCGATACCGTACTCGATACCGTACTCGATTCCGTACTAGAAACCGTACTCCACTCCGTACTCGATTCCGTACTCTAAGCCGTACTCGATACCGTACTCGACACCGTACTAGAACCCGTACTAAAGGCCGT'
] |
Unix timestamp of change (timestamp) | 1575059575 |