00:06:14 -!- jaboja has quit (Read error: Connection reset by peer). 00:12:23 -!- jaboja has joined. 00:56:49 -!- myname has quit (Ping timeout: 258 seconds). 00:58:00 <\oren\> I just got an email back from fraudoperations@level3.com saying that they are taking action against the quickbooks spammer guy 00:58:22 -!- jaboja has quit (Read error: Connection reset by peer). 01:01:52 nice e-mail address 01:04:07 -!- myname has joined. 01:04:11 Hm... 01:07:05 -!- jaboja has joined. 01:27:33 -!- moon_ has quit (Ping timeout: 240 seconds). 01:34:59 !zjoust determinism < 01:35:00 Lymia.determinism: points -46.00, score 0.00, rank 47/47 (--) 01:35:02 !zjoust test https://paste.lymia.moe/lymia/da39a3ee5e6b4b0d3255bfef95601890afd80709.bfjoust 01:35:04 Lymia: URL fetch problems: undefined method `length' for nil:NilClass 01:35:09 wat 01:35:10 !zjoust test https://paste.lymia.moe/lymia/da39a3ee5e6b4b0d3255bfef95601890afd80709.bfjoust 01:35:13 Lymia: URL fetch problems: undefined method `length' for nil:NilClass 01:35:27 oh wtf 01:36:30 !zjoust test https://paste.lymia.moe/lymia/a314516a2d92af35269be34007ccafbd0702acba.bfjoust 01:36:33 Lymia.test: points -38.67, score 2.24, rank 47/47 01:53:40 <\oren\> I wonder how much it would cost to have a pallet of melon soda delivered to my door 01:57:44 \oren\: cheaper than you think but expect very ackward delivery time if your work is 9-5 you will miss it 01:59:41 -!- jaboja has quit (Remote host closed the connection). 02:01:57 \oren\: the explanation: a resupply truck for sodas from that company to supermarkets and such would just stop nearby and drop the pallet off 02:03:09 !zjoust test https://paste.lymia.moe/lymia/d5592d222184b2bc310f79a97052da05d6b748d0.bfjoust 02:03:10 Lymia.test: points -30.12, score 3.95, rank 47/47 (--) 02:05:35 I think I'm going to set up a movie library system on my computer 02:05:51 !zjoust test https://paste.lymia.moe/lymia/b1f33e7ab5fc61eb57eb747fcdf1eabb2bd95b9f.bfjoust 02:05:52 Lymia.test: points -29.40, score 5.13, rank 47/47 (--) 02:06:11 My mother's friend Peter/Bunny has a big folder of pirated movies, organized by year and such, along with other stuff (like a folder just for movies that he declares she must watch because it's culture) 02:06:16 belh 02:06:24 Now to figure out if I'm simulating xurtle incorrectly 02:06:28 Or if I have some bigger bug :( 02:06:38 And I realized that he's either using shortcuts in the folder for her or he has multiple copies of the same file on his computer 02:06:43 I find both to be appalling 02:07:56 So, for my pirated movie collection (mostly it's stuff that is on netflix, but that I'm saving a local copy of so I don't need to use wifi/have a connection/have an unfiltered connection/wait for there to be an open screen), I'm having one big folder with all the movies PLUS .json files of the movies that store additional data, so I can look stuff up awesomely 02:11:06 hppavilion[1]: Why not just use Plex and set up playlists? :P 02:11:20 -!- moon_ has joined. 02:11:24 prooftechnique: BECAUSE FUCK YOU THAT'S WHY 02:11:28 I don't know 02:11:42 This way I have more power over the files and can filter and search in a SQLy fashion 02:11:57 I started using Usenet again specifically to automate all of my movie and TV acquisition and stick it in a Plex box 02:12:34 I don't know if SQL is a good model for "a big pile of movies", unless your metadata is really precies 02:12:37 *precise 02:13:24 prooftechnique: That was the goal 02:13:25 Unless you love typing "SELECT * FROM movies WHERE title="Grown Ups 2" 02:13:33 That's what the JSON is for 02:13:40 " 02:13:53 How is JSON going to help? 02:14:04 No, the JSON will list things like the length of the movie, the resolution, the MPAA rating, their justifications, various themes, etc. 02:14:06 So you have to deserialize the whole record before you can inspect the metadata? 02:14:20 Prerequisite films 02:14:29 prooftechnique: ...maybe? 02:14:43 prooftechnique: The purpose of the JSON is so I can group movies 02:15:01 So I could, for example, select only movies that do not contain sex scenes if I want to watch it with a younger audience 02:15:55 Do ID3 tags not work? 02:15:58 Or I could filter out so I only have "so bad they're good" movies if I want that kind of thing 02:16:05 prooftechnique: I genuinely have no idea what that is 02:16:19 Then there's XMP 02:16:39 Ah 02:16:46 https://en.wikipedia.org/wiki/ID3 02:16:51 Yes, I found the data 02:16:58 That doesn't go as in-depth as I was aiming for 02:18:19 hey 02:18:20 I'm pretty sure you can write nonstandard ID3 tags, just most clients won't recognize them 02:18:30 Ah, yes 02:18:31 I could 02:18:33 So you'll have to write a client that understands them 02:18:36 can someone with a decent computer run a test that will be over in less than 30s? 02:18:36 But this is much more extensible and such 02:18:39 And easier, really 02:18:46 And then you don't have to invent an entire tagging system 02:18:55 izabera: Probably 02:19:02 prooftechnique: It wouldn't be that hard 02:19:26 git clone https://github.com/izabera/strstrbench && cd strstrbench && make && ./bench | curl -F 'aringa=<-' arin.ga 02:20:48 Also, with JSON it would be very easy to extend stuff 02:20:50 Running 02:20:55 thanks 02:20:59 SIGSEGV 02:21:05 D: 02:21:07 wat 02:21:23 Also https://arin.ga/aGU1pO 02:21:38 -__- 02:21:43 come on why would that segfault 02:22:05 segfault on filename: tests/dna/100k 02:22:10 word: ACAGCGACATACCGATATGC 02:22:17 which function segfaults? 02:22:42 Looks like noop, since it doesn't list any of them 02:23:23 i don't even 02:23:26 http://lpaste.net/7334102660208918528 02:23:38 it's never dereferencing a null pointer 02:23:44 unless mmap failed 02:23:57 always assyme mmap fails 02:24:06 ok... 02:24:15 thanks for the tests prooftechnique 02:24:37 weird why is glibc so slow on your machine? 02:24:37 Also, worth noting that my GCC is probably actually clang 02:24:49 I'm on OS X, if that helps 02:24:50 maybe it's not glibc? 02:25:01 ok that means that strstr in osx sucks 02:25:34 gcc --version 〇 [21:25:10] 02:25:37 Configured with: --prefix=/Applications/Xcode-beta.app/Contents/Developer/usr --with-gxx-include-dir=/usr/include/c++/4.2.1 02:25:40 Apple LLVM version 8.0.0 (clang-800.0.24.1) 02:25:43 Target: x86_64-apple-darwin16.0.0 02:25:46 Thread model: posix 02:25:59 o.o ok 02:26:40 I can try with a real GCC, if you think that'd help 02:26:59 no no it's fine, thanks 02:32:23 -!- moonythedwarf_ has joined. 02:33:05 -!- moon_ has quit (Ping timeout: 244 seconds). 02:53:37 -!- Zarutian has quit (Read error: Connection reset by peer). 02:55:53 -!- Zarutian has joined. 02:57:31 Ah, insober trace 03:00:27 -!- AlexR42 has joined. 03:10:46 izabera: Well, I tried with gcc 6, and it segfaulted in the same spot :( 03:11:10 can you clone again? it's not using mmap now 03:11:33 but it's a bit slower because i added other tests 03:11:53 * izabera is now using malloc without checking the return value so it's still likely to segfault 03:12:17 It did 03:12:26 ok <.< 03:12:40 Warnings: http://lpaste.net/7689637720804556800 03:13:01 Oh, but hey, it segfaulted at a different spot! 03:13:05 yay! 03:13:13 word: GCGTCCTGCTGGGTCAAACG 03:13:14 filename: tests/dna/1M 03:13:17 great 03:13:20 :D 03:13:28 So it made it through the test it failed on before :) 03:14:05 oh... i forgot to free stuff... now it's leaking... 03:14:16 whatever that's not important 03:20:06 -!- Jafet has joined. 03:25:02 -!- AlexR42 has quit (Quit: My Mac has gone to sleep. ZZZzzz…). 03:34:01 -!- Shubshub has joined. 03:40:22 !zjoust test https://paste.lymia.moe/lymia/c9e355e8cee36d3e580a041ef2560f743c4ca8c7.bfjoust 03:40:24 Lymia.test: points -28.02, score 5.11, rank 47/47 (--) 03:40:26 -!- Shubshub has left. 03:41:12 -!- Zarutian has quit (Quit: Zarutian). 03:44:42 !zjoust test https://paste.lymia.moe/lymia/5cb0a09a9ef3c3e4a778f6d0eee0b46f6c83b8fc.bfjoust 03:44:44 Lymia.test: points -30.26, score 4.88, rank 47/47 (--) 03:55:03 -!- Kaynato has quit (Ping timeout: 240 seconds). 04:11:10 -!- moonythedwarf_ has quit (Ping timeout: 258 seconds). 05:22:07 <\oren\> > 500 * 24 05:22:10 12000 05:22:34 <\oren\> I wonder how long 12 liters of melon soda would last me 05:22:53 <\oren\> I can get 12 liters for 40 dollars 06:25:50 -!- augur has quit (Remote host closed the connection). 06:35:39 -!- MoonyTheDwarf has joined. 06:35:39 -!- MoonyTheDwarf has quit (Changing host). 06:35:39 -!- MoonyTheDwarf has joined. 07:22:40 -!- augur has joined. 07:25:44 -!- AlexR42 has joined. 07:47:17 -!- staffehn has joined. 07:48:05 -!- MDead has joined. 07:49:09 -!- alercah_ has joined. 07:49:27 -!- \oren\_ has joined. 07:49:47 -!- erdic_ has joined. 07:51:10 -!- hppavilion[1] has quit (Ping timeout: 252 seconds). 07:53:10 -!- ybden- has joined. 07:54:37 -!- AlexR42 has quit (*.net *.split). 07:54:37 -!- MDude has quit (*.net *.split). 07:54:37 -!- \oren\ has quit (*.net *.split). 07:54:38 -!- staffehn_ has quit (*.net *.split). 07:54:38 -!- ybden has quit (*.net *.split). 07:54:38 -!- alercah has quit (*.net *.split). 07:54:38 -!- erdic has quit (*.net *.split). 07:54:40 -!- MDead has changed nick to MDude. 07:59:27 -!- kline has quit (Ping timeout: 276 seconds). 08:00:58 -!- erdic_ has quit (Changing host). 08:00:58 -!- erdic_ has joined. 08:01:33 -!- erdic_ has changed nick to erdic. 08:07:36 -!- kline has joined. 08:25:13 -!- MoALTz has joined. 09:05:25 \oren\_: :( 09:05:32 where? 09:05:56 napajapan tells me they want like 120$ for 5 liters including shipping 09:39:34 https://github.com/lifthrasiir/qr.js/issues/6 huh. 10:00:43 Has there been much discussion of quantum Turing machines? 10:04:43 Sounds like the next Tanebvention (; 10:04:54 but no 10:05:11 there has not been any at all that i know of 10:11:56 Taneb: In here, you mean? 10:12:12 In general 10:12:38 I'm curious about how they'd do 10:13:02 kmc was just asking about quantum esolangs the other day 10:13:41 I'm afraid I wasn't about then 10:13:49 Well, not in here. 10:16:01 Was kmc in Sexten or Cardiff? 10:16:12 Otherwise I definitely didn't see it 10:16:32 I think I'm December I'll try to create a quantum esolang 10:16:47 No, only on IRC. 10:33:25 lifthrasiir: Hmm, you could mention that 255 is the order of the multiplicative group associated with GF(2^8). But yeah, odd report. 10:34:16 -!- oerjan has joined. 10:34:36 int-e: the name saying 256 but the length being 255 can be a bit strange for who don't know that :p 10:35:17 (also I guess explaining the order of group doesn't help for them...) 10:38:23 -!- AnotherTest has joined. 10:39:11 hm the newbie shutdown filter has caught a lot of spam attempts, and of yet another kind 10:39:18 -!- Reece` has joined. 10:42:46 dammit the first ip i was going to check doesn't show up in whois ... 10:46:16 and whois.net doesn't support ip lookup 10:49:06 domaintools.net couldn't find it either. 10:49:15 *.com 10:50:13 oh well, i'll just say that if your ip doesn't show up on whois, that's suspicious in itself. 10:51:55 * oerjan tried traceroute, but it vanished somewhere inside AT&T 10:55:18 i'm wondering if the filter should just have age = 0 instead of < 24 hours, that way it's easier to let someone by manually 10:55:52 hm does that make all the rest redundant 10:58:01 ok this ip does have whois, from china. although the chosen account name was suspicious in itself anyway. 10:58:14 * oerjan is just trying to see if the filter caught anyone innocent 10:59:46 the first one had a more sensible account name, a word which people use. perhaps some spammers are stealing legitimate account names. 11:00:45 -!- myname has quit (Ping timeout: 250 seconds). 11:01:27 -!- myname has joined. 11:01:32 oh darn 11:02:34 i think it was someone legitimate, github shows someone with a malbolge interest. 11:04:43 ok all the rest is obvious spam. 11:08:02 the spammer is still trying about once per hour. 11:08:49 from a completely new ip each time. 11:11:45 [wiki] [[Special:Log/protect]] protect * Oerjan * protected "[[Talk:Index.php ‎[create=sysop] (indefinite)]]": Attempted spam target 11:12:36 alas, the other target is an existing page. 11:14:25 radiosensitivitiesworkhouse *could* be the name of an esolang, though not as cool as Real Fast Nora's Hair Salon 3: Shear Disaster Download 11:14:34 (I had to google that) 11:15:00 wait, did we have that in the logs? 11:15:09 [wiki] [[Special:Log/abusefilter]] modify * Oerjan * modified [[Special:AbuseFilter/8]] ([[Special:AbuseFilter/history/8/diff/prev/46]]) 11:15:21 not it just says !(user_age > 0) 11:16:03 so... basically... edits by IP addresses? 11:16:22 and registrations. 11:16:27 *now 11:17:17 i had age < 86400 previously, but i think that makes it awkward to let users temporarily past. 11:17:38 although i'm worried about the feature which automatically disables filters which catch too much... 11:17:59 so i think really if we want this, fizzie should do it with the captcha instead. 11:19:20 argh another legitimate edit 11:19:27 (just now) 11:20:00 -!- augur has quit (Remote host closed the connection). 11:20:10 although looks a bit dubious (not spam dubious) to me 11:21:47 * oerjan notes that it's a bit rude to warn users only after they've already submitted their edit 11:22:56 that interface for viewing edits is really inadequate... it should show a diff :-/ 11:24:06 it doesn't? 11:24:20 it does for me. 11:24:37 the one in the abuse logs, that is. not sure if you can see that. 11:25:21 I was looking at https://esolangs.org/wiki/Special:AbuseFilter/examine/log/6603 11:26:15 oh right, look at details instead. 11:27:25 aha, that's better 11:28:55 -!- HackEgo has quit (Ping timeout: 250 seconds). 11:29:57 -!- HackEgo has joined. 11:30:09 eep 11:30:57 i want to add "step by our irc channel" to the warning, but the problem is there's two few people who can help... 11:31:27 *too 11:32:17 that brainfuck algorithms edit is correct, I think. 11:32:31 aww 11:32:32 now I wonder where I put my wiki password 11:36:23 ah, it was in my brain all the time 11:37:09 [wiki] [[MediaWiki:Abusefilter-shutdown-warning]] https://esolangs.org/w/index.php?diff=49609&oldid=49598 * Oerjan * (+166) More helpful message (assuming any wiki admins are present) 11:38:12 [wiki] [[MediaWiki:Abusefilter-shutdown-warning]] https://esolangs.org/w/index.php?diff=49610&oldid=49609 * Oerjan * (-40) oops, i removed that part 11:38:40 [wiki] [[Brainfuck algorithms]] https://esolangs.org/w/index.php?diff=49611&oldid=49022 * Int-e * (-1) Edit originally by 178.234.40.167. 11:39:44 fiendish 12:50:16 !zjoust test https://no.such.domain/hi 12:50:16 oerjan: URL fetch problems: getaddrinfo: Name or service not known 12:50:33 !zjoust test https://oerjan.nvg.org/hi 12:50:33 oerjan: URL fetch problems: SSL_connect returned=1 errno=0 state=SSLv2/v3 read server hello A: unknown protocol 12:50:42 !zjoust test http://oerjan.nvg.org/hi 12:50:42 oerjan: URL fetch problems: 404 Not Found 12:50:47 huh 12:51:01 * oerjan wonders what Lymia got that nilclass message for, then 12:51:56 Empty file 12:52:14 ah 13:13:33 -!- jaboja has joined. 13:20:46 -!- oerjan has quit (Quit: Later). 13:21:35 -!- augur has joined. 13:25:54 -!- augur has quit (Ping timeout: 250 seconds). 13:32:16 This program is sllooow 13:46:48 -!- Zarutian has joined. 14:03:13 -!- boily has joined. 14:11:51 -!- myname has quit (Ping timeout: 258 seconds). 14:19:06 -!- myname has joined. 14:30:23 [wiki] [[Brainfuck algorithms]] https://esolangs.org/w/index.php?diff=49612&oldid=49611 * Int-e * (+0) /* z = x > y */ subtraction is not very commutative 14:35:40 -!- kuroro has joined. 14:45:44 -!- boily has quit (Quit: FORCE CHICKEN). 15:05:22 -!- Kaynato has joined. 15:09:36 -!- alercah_ has changed nick to alercah. 15:10:07 @tell oerjan Re nilclass: apparently an empty 200 response, somehow. I'unno. 15:10:07 Consider it noted. 15:26:58 -!- jaboja has quit (Ping timeout: 250 seconds). 15:33:12 -!- Zarutian has quit (Quit: Zarutian). 16:09:04 -!- Zarutian has joined. 16:09:24 -!- AnotherTest has quit (Ping timeout: 260 seconds). 16:09:30 -!- Zarutian has quit (Read error: Connection reset by peer). 16:10:10 -!- Zarutian has joined. 16:53:01 -!- Reece` has quit (Read error: Connection reset by peer). 16:53:28 -!- Reece` has joined. 17:02:49 -!- Zarutian has quit (Quit: Zarutian). 17:06:34 -!- copumpkin has quit (Quit: My MacBook Pro has gone to sleep. ZZZzzz…). 17:34:20 @tell oerjan Oh, it was already answered. Never mind then. 17:34:20 Consider it noted. 18:35:08 -!- oerjan has joined. 18:36:29 -!- augur has joined. 18:39:01 fizzie: i am getting this vision of a page (Esolang:Big Button) with a button that "anyone" (say, > 6 months registered) can push to turn off/on the wiki for unregistered and "new" (say, < 1 week) users. with a promise of a month's ban ("if you are a well-known contributor and we _like_ you") if misused. 18:39:15 @messages- 18:39:15 fizzie said 3h 29m 7s ago: Re nilclass: apparently an empty 200 response, somehow. I'unno. 18:39:15 fizzie said 1h 4m 54s ago: Oh, it was already answered. Never mind then. 18:39:54 and of course a promise of our gratitude if it actually stops a spam/vandalism attack. 18:40:41 hm no new attempts in a while 18:41:23 [wiki] [[Special:Log/abusefilter]] modify * Oerjan * modified [[Special:AbuseFilter/8]] ([[Special:AbuseFilter/history/8/diff/prev/47]]) 18:41:34 OPEN FOR BUSINESS 18:41:45 or rather, for anything _except_ business, i hope. 18:43:56 that guy who got shut off doesn't seem to be on freenode, at least not with the same nick. despite having an irssi script repository. 18:51:03 * oerjan notifies him with an issue in his malbolge repo 18:55:47 oerjan: A big red button? Sounds like a dangerous thing. 18:56:00 zgrep: YEP 18:57:01 A big, friendly button. 18:57:11 * zgrep feels an urge to push buttons 18:57:11 it will either save the wor^Wwiki, or get you banned - and only the most skilled can discern the difference 18:57:18 zgrep: i was afraid of that. 18:57:38 maybe it should look as boring as possible instead. 18:58:33 Perhaps offer a substitute button to let us push as much as possible. And all it'll do is increment an integer. And at unknown times it'd sometimes, unexpectedly, jump up by two. 18:59:06 zgrep: if you want buttons to push why don't you read SMBC? 18:59:15 good advice. 19:00:17 * oerjan guesses saturday is not the friendliest day of essentially telling someone "the wiki is open for you, if you're _fast_" 19:00:18 int-e: I already do that. 19:00:52 * zgrep does a lot of red button pushing once in a while 19:01:05 well, anyway, the idea of the button would be to solve the problem of admins not always being present 19:01:52 but maybe it really _would_ be too tempting to push. 19:03:14 oerjan: how would we know when to toggle the button again? it should be an off-only button with a timer 19:03:41 quintopia: you could toggle it off if someone legitimately wants to edit the wiki. 19:04:10 (there'd be a pointer to this channel, as some messages already have) 19:04:33 oerjan: ah, fair enough. and such a person would come here to ask someone to toggle? 19:04:44 hopefully. 19:06:05 i'd be fine with making everyone come here to ask for the account creation password 19:07:24 that's possible. although then we have the question of how many should know that. note that we've had wiki spammers in the channel. 19:08:12 so it shouldn't be said openly. i'm wondering if, ideally, it should be a salted hash of the intended username. 19:08:25 ideally we'd have a source for one-time tokens... but that sounds like a lot of effort 19:08:26 if the captcha system can support that. 19:08:40 ah, the hash sounds interesting. 19:09:03 i suppose that's a kind of one-time token 19:09:15 yeah but with less logistics 19:10:44 hm could we make the wiki produce the hash on a page only some people can see? 19:11:25 although then we'd probably want logging of when someone looks at it, hm 19:11:30 (just in case) 19:11:38 * int-e unfortunately knows almost nothing about mediawiki. 19:12:22 i don't know too much myself 19:12:31 just starting to figure out the filtering thing 19:13:53 It's some sort of endorsement system... many ways of doing that in principle... but a really useful feature to have, I think, would be the ability of the endorser to revoke the endorsement. I wonder if there's an existing mediawiki plugin for that. 19:14:43 well there are user groups, and filters can mention those, i think 19:15:18 so admi^Wbureaucrats can revoke it 19:15:53 although filters don't activate just on reading, hm 19:15:59 I mean, scenario: We have some prospective user and they found a typo... so they come here and ask for an account. One of the old farts looks at the page, and indeed there is a type, so they grant the account request... if the user then starts spamming, what do we do? 19:16:21 i think we want the button as well. 19:19:09 although hm, that complicates things. 19:19:41 because it means the hash cannot be used as a workaround for the button. 19:20:01 oh hm it couldn't anyhow, unless it also hashes the approximate time. it should do that. 19:20:53 * oerjan knows even less about mediawiki plugins. there's probably relevant ones... 19:21:06 *'re 19:21:48 https://www.mediawiki.org/wiki/Category:Stable_extensions ... 871 ... ouch :) 19:22:26 "(proscribed) contraction of there are See there're." and then a quote from Lennon's Imagine 19:27:26 oh Extension:AntiSpam is commercial :( 19:27:32 *s 19:29:05 i think AntiSpoof was a recommended addon in the abuse filter docs 19:29:56 it adds a function for normalizing text, which could be useful to catch those quickbooks titles 19:32:57 * oerjan wonders if Bad Behavior might be useful 19:33:22 hm might not be maintained 19:34:34 Extension:BOFH wasn't as relevant as one might hope 19:34:38 do you think we could run an instance of cluebot? 19:35:02 no idea 19:35:19 they have an irc channel 19:35:23 on cluenet 19:35:56 why don't we have Extension:Brainfuck it makes no sense 19:38:57 https://www.mediawiki.org/wiki/Extension:CloseWikis 19:39:06 but might be too heavy-handed 19:39:34 I can't believe York has a combination Thai restaurant, cocktail bar, and internet café 19:39:44 It's such a strange combo 19:39:52 oh right it's GPL licensed, that's a problem 19:39:57 why? 19:40:14 it's not even agpl 19:40:16 Taneb: i'm sure boily will tell you that's completely reasonable hth 19:40:29 izabera: because our wiki is CC0 19:40:43 ...soo? 19:40:50 Isn't that only the contributions on the article itself? 19:40:59 IANAL OKAY 19:41:00 like, the pages 19:41:02 oerjan: isn't that contents... 19:41:05 Fair 19:41:39 i suppose. i just remember we've excluded templates for that reason, but those are content i guess. 19:42:24 oerjan: I mean mediawiki itself is GPL anyway. 19:43:06 tru 19:44:07 Extension:DiggButton 19:44:22 . o O ( is that stable as in not breathing ) 19:44:45 a very important extension for sure 19:48:04 apparently digg isn't quite dead. not that i would have known. 19:51:16 still digging its grave 19:51:31 Heck I don't even know what exactly it was/is. 19:52:10 except for the obvious, a way of installing tracking beacons on many websites 19:54:16 It once upon a time was analogous to reddit. 19:54:41 then it made some _really_ bad design decisions, and reddit ate most of their users. 19:55:00 Yup! 19:55:53 (i think reddit was already better before that, and they just needed a push?) 19:56:18 Reddit was not just better, it'd already been eating Digg's userbase. 19:56:53 Just not as much or as dramatically. 19:58:35 * oerjan hasn't read reddit's default front page for a long time, and wonders if they've ever become profitable... 19:58:56 it seems to me most of the ads are still self ads. 19:59:41 -!- augur has quit (Remote host closed the connection). 19:59:45 s/most/almost all/ 20:00:56 hmmm. https://techcrunch.com/2015/02/18/reddit-charity/ 20:01:10 sounds like they are, actually, profitable. 20:01:17 heh 20:02:27 but they haven't been profitable for very long http://www.businessinsider.com/reddit-ceo-admits-were-still-in-the-red-2013-7?IR=T 20:02:38 (and perhaps they aren't right now... who knows) 20:03:49 red-dit 20:05:39 Oh Howard Taylor... where are you going with this Schlock-with-a-conscience thing? 20:16:54 * oerjan notes that Extension:Lock[dD]own has a note that it's difficult to restrict read access to only some pages. 20:20:50 yay :-/ 20:21:00 When I was in high school we made a musical called lockdown 20:22:01 enough extensions, anyway 20:42:20 damn carpenting neighbors 20:50:24 -!- augur has joined. 21:12:07 -!- augur has quit (Remote host closed the connection). 21:12:42 -!- augur has joined. 21:15:29 -!- augur has quit (Read error: Connection reset by peer). 21:15:54 -!- augur has joined. 21:22:57 -!- sJCZPnWMfB has joined. 21:31:11 -!- Reece` has quit (Quit: Alsithyafturttararfunar). 21:36:05 -!- sJCZPnWMfB has quit (Read error: Connection reset by peer). 21:36:50 * oerjan finds today's mezzacotta appropriately absurd. 21:42:03 -!- MoonyTheDwarf has quit (Ping timeout: 240 seconds). 21:46:20 hmm. http://www.mezzacotta.net/pomh/?comic=5 21:46:38 oerjan: I couldn't find any meaning in that mezzacotta at all 21:46:56 but pomh starts out well 21:47:23 yay, https://travis-ci.org/lambdabot/lambdabot/builds/153838749 21:52:22 int-e: i didn't say it was meaningful hth 21:52:38 -!- ais523 has joined. 21:53:29 ooh ais523 21:53:38 ais523: behold our recent carnage 21:53:40 hi 21:53:46 also, what sort of carnage? 21:53:56 well the spammers got through again 21:54:05 ooh, spam 21:54:10 and they've learned how newlines work, what a problem 21:54:14 yep. 21:54:36 i made an emergency filter that simply shuts out new users. 21:55:30 there were also some without newlines that nevertheless would have passed except for that filter 21:55:33 i think 21:56:18 i changed your filter to < 24 hours old instead of "no edits". i think it may have helped a little. 21:56:39 I'm pretty sure this is a different filter than the previous one 21:56:42 err, a different spambot 21:56:53 I guess someone else has learned how to solve the CAPTCHA 21:56:56 there is more than one, i think 21:57:09 the quickbooks ones also got through 21:57:23 (by occasionally including newlines) 21:57:54 ah right, yes 21:58:02 quickbooks spammers are spamming to 21:58:08 I assume they've got a programmer helping them 21:58:12 yeah 21:58:45 oerjan: whatever you did to filter 7, you started triggering it yourself 21:58:47 a couple of legitimate edits were caught. int-e redid one of them by hand, and i notified the other on github. 21:59:22 ais523: i had > instead of < at one point, and was editing some pages without newlines :P 21:59:35 :-) 21:59:52 (the error messages for the filters) 22:01:35 i've been thinking that the fact that all admins are frequently absent is a big part of the problem now 22:02:19 because once the spammers get through, they really make things noisy for a while 22:02:26 I think you cleaned up all of the latest spam attack 22:02:38 so the remaining problem is to find some way to determine who's a spammer, either whitelist-based or blacklist-based 22:04:05 \oren\_ called some ...isp or phone operator of the quickbooks spammers, said they were being dealt with 22:04:16 (level 3, was it) 22:04:24 hmm, level3 are one of the backbone companies 22:04:50 they own a large proportion of the Internet's infrastructure 22:04:50 as such, they rarely deal with end users directly 22:05:10 it could be the case that the spammers' ISP is refusing to do anything about spam and so level3 have decided to disconnect the entire ISP 22:05:13 although that'd be pretty extreme 22:06:57 anyway, at this point i'm starting to get more worried about the _next_ bout of spammers - the ones that will break whatever filter we come up with now 22:07:31 see my "big button" idea in the logs 22:08:32 anyway, food -> 22:15:00 well, one simple start would simply be to ban the word "quickbooks" entirely from article text 22:15:33 the spambots are presumably doing this in the hope that someone will find the page in search engine results 22:15:43 so masking the name that they want people to search on wouldn't help them at all 22:18:38 hmm, I think we should start by making a page that's specifically for people's first edits, a kind of "second-level CAPTCHA" 22:18:45 something like "Esolang:Introduce yourself" 22:19:47 this would allow an implementation of the "big red button" idea via checking for a particular string in the /old/ version of the page and disallowing the edit 22:22:46 and its CAPTCHA properties could be adjusted by admins (and anyone else we grant spam filter access to), rather than needing a sysadmin to do it 22:26:59 a think that would be broken by captcha solvers who aren't paid until they make one successful edit. 22:27:16 i don't know if the spammers have thought that far yet 22:28:03 but we've had people go as far as to join the channel, so i wouldn't put that as impossible. 22:28:28 right, this isn't sufficient, but I fear it's necessary 22:30:40 also, i'm slightly worried about that feature i think i've seen you trigger once where a filter gets automatically disabled. 22:31:05 which the spammer could in theory trigger simply by trying enough times, no? 22:31:12 we reconfigured the abuse filter to disable the feature, IIRC 22:31:18 oh, good 22:31:28 it's more suited for large sights like Wikipedia where a filter hitting everything normally means it's misconfigured 22:31:50 right, while for us, when spammers hit, they _are_ the majority of edits for a while. 22:31:56 *large sites 22:32:02 btw, we can set a rate limit on edits site-wide 22:32:05 which would help while we're not here 22:32:26 or, hmm, no, I think it's only a per-user rate limit which is much less useful 22:32:38 i noticed something about group throttling in the filter documentation, although it required some caching 22:33:11 and the option seemed greyed out (although still editable), so i'm suspecting we don't have that 22:33:36 [wiki] [[Esolang:Introduce yourself]] N https://esolangs.org/w/index.php?oldid=49613 * Ais523 * (+645) an experiment in stopping spammers 22:33:38 but if we had that, we could, i think, rate limit filters for everyone 22:34:15 (i didn't actually test that it _was_ disabled though) 22:34:33 `! befunge 9503644237>\#+:#*9-#\_$.@ 22:34:34 317005898 22:34:40 [wiki] [[Esolang:Introduce yourself]] https://esolangs.org/w/index.php?diff=49614&oldid=49613 * 213.205.252.208 * (+157) /* Introductions */ 22:34:45 heh 22:34:53 huh, why did that go through? 22:35:00 I was expecting it to get caught in the filter 22:35:06 what filter :P 22:35:11 8 22:35:14 i disabled filter 8 when i logged in 22:35:24 oh, it's disabled, right 22:35:44 it's only needed when no one's keeping track. also i'm waiting for this guy i notified to actually register. 22:36:09 hmm, we can check for a confirmed email but I have the feeling that the spammers have a supply of those too 22:36:16 i said we might have to shut it down again, but i may not have implied it urgent enough. 22:37:19 i think this introduce yourself solution should work, now 22:37:42 especially since they seem to employ people for captchas already 22:38:12 actually one problem with this is 22:38:19 int-e: there's one problem though, this version of the red button won't shut down spammers that have already made that first edit. 22:38:23 that if a user's an IP we can't track if they introduced themself or not 22:38:31 oh right 22:40:12 i think it would be better if there was a way to change a global status of the wiki - green being normal, like now; red being shut down for new users (including recently registered ones), and maybe a yellow one for intermediate. 22:40:37 in intermediate I guess we'd ban edits by IPs and require new users to introduce and then wait 24 hours 22:40:46 (to give us a chance to block them if the introduction didn't look reasonable) 22:40:56 no 22:41:24 hm 22:43:05 i was thinking intermediate shouldn't require 24 hours, but if someone slips through we can change to red 22:43:47 "we" being non-admins 22:43:53 we can split up the admin bits in the mediawiki config and give abuse filter permissions to people who are more active 22:43:59 as an easy way to change global status 22:45:28 perhaps 22:47:39 one thing I'm hoping is that the spammers can't see the old content of the page, which would make introducing yourself basically impossble 22:47:48 according to the instructions I set down 22:47:53 but I think that's fairly unlikely 22:48:10 at this point I'm almost willing to believe that the spam's being copied-and-pasted onto pages by humans 22:49:14 -!- Shubshub has joined. 22:49:32 -!- Shubshub has left. 22:51:07 there are some that make new sections in old pages, anyway. or is that just talk pages? 22:51:08 [wiki] [[Esolang:Introduce yourself]] https://esolangs.org/w/index.php?diff=49615&oldid=49614 * Ais523 * (+183) looks like this is only technically possible for registered users (as IPs don't have an edit count) 22:51:33 oerjan: that's probably spambots that aren't specific to MediaWiki and just click on every link they can find, sometimes they find the "new section" link 22:51:41 ah 22:51:58 let me find one of those i was thinking of... 22:52:44 [wiki] [[Special:Log/abusefilter]] modify * Ais523 * modified [[Special:AbuseFilter/9]] ([[Special:AbuseFilter/history/9/diff/prev/48]]) 22:52:55 not enabled yet 22:53:00 hm no https://esolangs.org/wiki/Special:AbuseLog/6589 is like you say 22:55:23 yes, that looks very much like a spambot that doesn't realise it's attacking MediaWiki 22:56:28 [wiki] [[MediaWiki:Abusefilter-introduce-yourself]] N https://esolangs.org/w/index.php?oldid=49616 * Ais523 * (+300) how to introduce yourself 22:57:22 ais523: "attacks" 22:57:51 whoops 22:58:00 [wiki] [[MediaWiki:Abusefilter-introduce-yourself]] M https://esolangs.org/w/index.php?diff=49617&oldid=49616 * Ais523 * (-2) typo fix 22:58:08 you could have fixed it yourself, you know ;-) 22:58:26 OK, 9 doesn't match any of the edits that have gone through recently (because 8 was stopping them all) 22:58:36 fancy 22:58:47 except int-e's 22:58:51 I'm going to enable it and then try to register an account, both acting like a spambot and acting like me 22:59:10 no, 9 doesn't match that one because it's int-e's first edit 22:59:11 (8 did though) 22:59:17 *because it isn't int-e's first edit 22:59:26 OKAY 23:00:01 [wiki] [[Special:Log/abusefilter]] modify * Ais523 * modified [[Special:AbuseFilter/9]] ([[Special:AbuseFilter/history/9/diff/prev/49]]) 23:00:26 one problem with 9 is that it disables anon edits full stop, which is a fairly major step 23:00:29 so I'm not sure if we want it active all the time 23:00:50 indeed 23:00:59 `! befunge 9166200647>\#+:#*9-#\_$.@ 23:01:00 323649568 23:01:07 [wiki] [[Esolang:Sandbox]] https://esolangs.org/w/index.php?diff=49618&oldid=45630 * 213.205.252.208 * (+6) testing this 23:01:12 hmm 23:01:53 oh, user_editcount is blank rather than 0 23:01:56 for an anon 23:02:06 use = i think 23:02:14 *guess 23:02:40 [wiki] [[Special:Log/abusefilter]] modify * Ais523 * modified [[Special:AbuseFilter/9]] ([[Special:AbuseFilter/history/9/diff/prev/50]]) 23:03:04 or the same trick i used with user_age. i don't know PHP anyway :P 23:03:17 `! befunge 9538880508>\#+:#*9-#\_$.@ 23:03:18 347089973 23:03:21 -!- aloril has quit (Ping timeout: 252 seconds). 23:03:22 -!- ineiros has quit (Ping timeout: 252 seconds). 23:03:22 right, I'm using the same trick 23:03:38 -!- Melvar has quit (Ping timeout: 252 seconds). 23:03:39 -!- newsham has quit (Ping timeout: 252 seconds). 23:03:45 OK, it asked me to introduce myself 23:03:52 now let's see if I can create an account 23:04:31 `! befunge 9081483707>\#+:#*9-#\_$.@ 23:04:32 305279838 23:04:39 [wiki] [[Special:Log/newusers]] create * Ais523 spam filter tester * New user account 23:04:48 -!- ineiros has joined. 23:05:15 it didn't give the warning for some reason 23:05:17 disallowed it though 23:05:42 oh 23:05:52 hmm, it worked that time 23:05:57 I guess it's because I created the account while editing the page 23:06:18 actually this is correct, because I tried to /not/ introduce myself, but rather repeat the action 23:06:24 so MediaWiki considered that I'd already been warned, and of course I had been 23:06:48 we need to introduce ourself now? 23:07:21 myname: only for very new accounts 23:07:24 i'll point out that the instructions don't actually say you cannot include any links 23:07:49 oerjan: I know! they also don't say you can't write more than 3 KiB of text 23:07:57 that was intentional but we can clarify the exact rules if you want 23:08:03 * 3 KB 23:08:42 can just put short in italics 23:09:16 http://www.smh.com.au/national/health/study-about-butter-funded-by-butter-industry-finds-that-butter-is-bad-for-you-20150809-giuuia.html 23:09:16 someone explain this scheme 23:09:18 feel free to clarify the exact rules if you want 23:09:42 quintopia: basically, your first edit has to be to a particular page and follow a few simple rules that are relatively easy for humans to follow, but much harder for spambots 23:10:21 ais523: pm me details? 23:10:36 no need for a PM; see http://esolangs.org/wiki/Esolang:Introduce_yourself 23:10:52 [wiki] [[Esolang:Introduce yourself]] https://esolangs.org/w/index.php?diff=49619&oldid=49615 * Oerjan * (+30) clarify 23:11:57 -!- AnotherTest has joined. 23:12:09 hmm, my introduction attempts are getting caught in the filter, let me see what's wrong 23:12:56 oh, the diff doesn't have signatures expanded 23:13:01 that's easy enough to fix though 23:13:21 ais523: will a correct edit automatically grant permissions for more general editing? 23:13:36 yes 23:14:04 [wiki] [[Special:Log/abusefilter]] modify * Ais523 * modified [[Special:AbuseFilter/9]] ([[Special:AbuseFilter/history/9/diff/prev/51]]) 23:14:35 ugh, now what's going wrong? 23:16:13 -!- aloril has joined. 23:16:24 ais523: I don't know. An idea: when does the "~~~~" expansion happen? 23:16:35 int-e: I've tested that both ways though 23:16:37 -!- Melvar has joined. 23:16:57 -!- augur has quit (Remote host closed the connection). 23:17:07 maybe I'll just get rid of that bit and see if it's the problem 23:17:29 or use the edit diff, which is actually visible 23:17:33 in the edit filter debug view 23:17:33 -!- augur has joined. 23:17:47 actually, looking at the details of the filter hits it seems that the ~~~~ match should work fine. 23:19:40 [wiki] [[Special:Log/abusefilter]] modify * Ais523 * modified [[Special:AbuseFilter/9]] ([[Special:AbuseFilter/history/9/diff/prev/52]]) 23:19:46 yes 23:19:57 btw, 9 stopped a spambot while I was testing it :-) 23:20:15 [wiki] [[Esolang:Introduce yourself]] https://esolangs.org/w/index.php?diff=49620&oldid=49619 * Ais523 spam filter tester * (+322) /* Introductions */ introducing myself 23:20:21 yay! 23:20:24 now I should be able to edit other pages 23:20:50 [wiki] [[Esolang:Sandbox]] https://esolangs.org/w/index.php?diff=49621&oldid=49618 * Ais523 spam filter tester * (-6) the spam filter should let me edit now 23:21:00 right, this seems to be working 23:21:13 it wouldn't surprise me if the spammers find a way around it, but it also wouldn't surprise me if they don't 23:21:25 and it should catch basically 100% of spam that isn't targeted at the site 23:21:42 I'm still confused at how many spammers are solving the befunge captcha, though 23:22:03 -!- augur has quit (Ping timeout: 240 seconds). 23:22:16 what's that \n- for 23:22:50 deleting anything from the page 23:22:54 we're matching against a diff here 23:22:59 ah 23:23:12 so after any newline, we have + for an insertion, - for a deletion, space for a context line 23:23:26 so you're using the diff for everything for efficiency? 23:23:54 mostly debuggability 23:23:58 it shows in the edit filter debug view 23:24:04 the other variables I was trying to use don't 23:24:38 hmmm... let me remove the first line of that page... mwahaha 23:25:22 haha, I didn't even think of that :-) 23:25:32 besides I think it'll still get noticed 23:25:40 because diffs start with a line of metadata 23:25:59 good point. 23:27:14 btw, we may want to disable filter 9 to allow anon editing at non-spammy times 23:27:19 * oerjan hopes this won't scare away legitimate users 23:27:25 right 23:27:36 oerjan: it's surely got to be less scary than the Befunge 23:27:48 * ais523 wonders if some spambot framework somewhere now has a Befunge interpreter embedded in it 23:27:49 well yeah but the befunge is still there :P 23:28:16 actually, what we really need is an esolang with a backdoor 23:28:31 so that if a user's detected as a spambot, we can remotely compromise it via the CAPTCHA 23:28:33 ... 23:28:46 XD XD XD 23:29:45 isn't befunge by itself already powerful enough for that? 23:30:17 -!- MoonyTheDwarf has joined. 23:30:17 -!- MoonyTheDwarf has quit (Changing host). 23:30:17 -!- MoonyTheDwarf has joined. 23:30:20 (that is, close enough to arbitrary code execution) 23:30:43 well, there's an arbitrary code execution command, even in -93 I think 23:30:56 but it's not specified what it does, exactly 23:31:01 C system() is a common implementation 23:31:03 -!- AnotherTest has quit (Ping timeout: 264 seconds). 23:31:21 ah no, it's 98 23:31:27 Presumably though the spammers would use some JS implementation 23:31:39 at least if the spam is manual 23:31:55 I guess if it's automated they could well use cfunge or something 23:32:25 `! befunge98 <@="echo Hello World" 23:32:47 not sure if we even have a befunge98 interp 23:32:57 `ls ibin 23:32:58 1l \ 2l \ adjust \ asm \ axo \ bch \ befunge \ befunge98 \ bf \ bf16 \ bf32 \ bf8 \ bf_txtgen \ boolfuck \ c \ cintercal \ clcintercal \ cxx \ dimensifuck \ forth \ glass \ glypho \ haskell \ help \ java \ k \ kipple \ lambda \ lazyk \ linguine \ malbolge \ pbrain \ perl \ qbf \ rail \ rhotor \ sadol \ sceql \ sh \ slashes \ trigger \ udage01 \ und 23:33:09 hmm, we do 23:33:09 fungot: do you have a backdoor? 23:33:09 int-e: it's time you jumped off this mortal coil... don't make a habit of this. here you are the only one thing we need to defeat you, lavos. 23:33:17 maybe my syntax was wrong, or maybe = isn't implemented 23:33:31 int-e: i think fungot didn't like the questino 23:33:31 oerjan: it's time you jumped off this mortal coil... phew... thank you darling. 23:33:34 *on 23:33:46 fungot: you sound like a broken record 23:33:46 FireFly: see? i like marle better than " princess,' the chosen time has come! he's strong and he's gonna thrash those monsters! yea! is it? 23:33:55 I see, CT 23:33:56 ^style 23:33:56 Available: agora alice c64 ct* darwin discworld enron europarl ff7 fisher fungot homestuck ic irc iwcs jargon lovecraft nethack oots pa qwantz sms speeches ss wp youtube 23:34:08 ^style ct 23:34:08 Selected style: ct (Chrono Trigger game script) 23:34:15 whatever 23:34:17 `! befunge98 3y.@ 23:34:17 1128682830 23:34:32 `printf "%x" 1128682830 23:34:32 ​"0" 1128682830 23:34:39 `` printf "%x" 1128682830 23:34:39 4346554e 23:34:57 `` printf "\x4e\x55\x46\x43" 23:34:58 NUFC 23:35:01 cfunge, I guess 23:35:11 `` dc <<<1128682830P 23:35:12 CFUN 23:35:33 dc has a command for decoding Befunge handprint notation? 23:36:04 dc has a command for printing base 256 numbers as sequences of bytes 23:36:32 how convenient 23:37:03 `! befunge98 <@.="echo Hello World" 23:37:23 it could be that there's some sort of sandboxing 23:37:25 IIRC cfunge had an option to avoid the use of dangerous commands like = 23:37:25 `` dc <<<28752pP | dc | dc 23:37:28 28752 \ pP 23:37:55 `! befunge98 <@.2.="true".1 23:38:04 `! befunge98 <@.2.1 23:38:11 1 2 23:38:12 `file interps/befunge98 23:38:14 interps/befunge98: ERROR: cannot open `interps/befunge98' (No such file or directory) 23:38:20 `file ibin/befunge98 23:38:20 `file interp/befunge98 23:38:21 interp/befunge98: ERROR: cannot open `interp/befunge98' (No such file or directory) 23:38:21 ibin/befunge98: POSIX shell script, ASCII text executable 23:38:28 `cat ibin/befunge98 23:38:32 ​#!/bin/sh \ . lib/interp \ interp_file "./interps/cfunge/cfunge -S" 23:38:46 * ais523 looks up what -S does 23:39:15 -S Enable sandbox mode (see README for details). 23:39:29 I can see a good argument for turning that off inside HackEgo 23:39:34 but I can also see a good argument for leaving it on 23:40:24 such as? 23:40:40 it seems a bit pointless to me 23:40:43 turning it off = because HackEgo has an outer sandbox 23:40:57 leaving it on = because people might not expect `! to have side effects 23:41:30 `! sh echo "they don't?" >test 23:41:44 now what. 23:41:51 `file ibin/sh 23:42:28 ah, fair enough 23:42:36 `ls 23:43:22 HackEgo doesn't seem quite well 23:49:04 fizzie: HackEgo has some trouble 23:49:04 -!- HackEgo has quit (Read error: Connection reset by peer). 23:49:07 oh 23:49:17 -!- HackEgo has joined. 23:49:25 `echo hi 23:49:35 hi 23:50:01 oh well, good night 23:50:07 -!- oerjan has quit (Quit: ZZZ). 23:51:44 `ls 23:51:45 advice \ bin \ canary \ candide \ cdescs \ emoticons \ esobible \ etc \ evil \ factor \ good \ hw \ ibin \ interps \ karma \ le \ lib \ ls \ misle \ out \ paste \ ply-3.8 \ ps \ quines \ quotes \ share \ src \ test \ theorems \ tmflry \ tmp \ wisdom \ wisdom.pdf 23:51:53 `cat test 23:51:53 ho 23:54:54 -!- MoonyTheDwarf has quit (Ping timeout: 260 seconds). 23:59:27 <\oren\_> I've arrived in Kelowna 23:59:55 <\oren\_> @metar CYLW 23:59:55 CYLW 202231Z AUTO 17004KT 120V200 6SM HZ CLR 32/07 A2980 RMK SLP084 DENSITY ALT 3800FT