< 1471651574 0 :jaboja!~jaboja@2a00:f41:385e:6339:de85:deff:fe55:967a QUIT :Read error: Connection reset by peer < 1471651943 0 :jaboja!~jaboja@2a00:f41:385e:6339:de85:deff:fe55:967a JOIN :#esoteric < 1471654609 0 :myname!~myname@84.200.43.57 QUIT :Ping timeout: 258 seconds < 1471654680 0 :\oren\!~oren@ec2-52-2-213-98.compute-1.amazonaws.com PRIVMSG #esoteric :I just got an email back from fraudoperations@level3.com saying that they are taking action against the quickbooks spammer guy < 1471654702 0 :jaboja!~jaboja@2a00:f41:385e:6339:de85:deff:fe55:967a QUIT :Read error: Connection reset by peer < 1471654912 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :nice e-mail address < 1471655047 0 :myname!~myname@84.200.43.57 JOIN :#esoteric < 1471655051 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :Hm... < 1471655225 0 :jaboja!~jaboja@2a00:f41:385e:6339:de85:deff:fe55:967a JOIN :#esoteric < 1471656453 0 :moon_!~IceChat9@unaffiliated/moonythedwarf QUIT :Ping timeout: 240 seconds < 1471656899 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :!zjoust determinism < < 1471656900 0 :zemhill__!bfjoust@selene.zem.fi PRIVMSG #esoteric :Lymia.determinism: points -46.00, score 0.00, rank 47/47 (--) < 1471656902 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :!zjoust test https://paste.lymia.moe/lymia/da39a3ee5e6b4b0d3255bfef95601890afd80709.bfjoust < 1471656904 0 :zemhill__!bfjoust@selene.zem.fi PRIVMSG #esoteric :Lymia: URL fetch problems: undefined method `length' for nil:NilClass < 1471656909 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :wat < 1471656910 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :!zjoust test https://paste.lymia.moe/lymia/da39a3ee5e6b4b0d3255bfef95601890afd80709.bfjoust < 1471656913 0 :zemhill__!bfjoust@selene.zem.fi PRIVMSG #esoteric :Lymia: URL fetch problems: undefined method `length' for nil:NilClass < 1471656927 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :oh wtf < 1471656990 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :!zjoust test https://paste.lymia.moe/lymia/a314516a2d92af35269be34007ccafbd0702acba.bfjoust < 1471656993 0 :zemhill__!bfjoust@selene.zem.fi PRIVMSG #esoteric :Lymia.test: points -38.67, score 2.24, rank 47/47 < 1471658020 0 :\oren\!~oren@ec2-52-2-213-98.compute-1.amazonaws.com PRIVMSG #esoteric :I wonder how much it would cost to have a pallet of melon soda delivered to my door < 1471658264 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is PRIVMSG #esoteric :\oren\: cheaper than you think but expect very ackward delivery time if your work is 9-5 you will miss it < 1471658381 0 :jaboja!~jaboja@2a00:f41:385e:6339:de85:deff:fe55:967a QUIT :Remote host closed the connection < 1471658517 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is PRIVMSG #esoteric :\oren\: the explanation: a resupply truck for sodas from that company to supermarkets and such would just stop nearby and drop the pallet off < 1471658589 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :!zjoust test https://paste.lymia.moe/lymia/d5592d222184b2bc310f79a97052da05d6b748d0.bfjoust < 1471658590 0 :zemhill__!bfjoust@selene.zem.fi PRIVMSG #esoteric :Lymia.test: points -30.12, score 3.95, rank 47/47 (--) < 1471658735 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :I think I'm going to set up a movie library system on my computer < 1471658751 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :!zjoust test https://paste.lymia.moe/lymia/b1f33e7ab5fc61eb57eb747fcdf1eabb2bd95b9f.bfjoust < 1471658752 0 :zemhill__!bfjoust@selene.zem.fi PRIVMSG #esoteric :Lymia.test: points -29.40, score 5.13, rank 47/47 (--) < 1471658771 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :My mother's friend Peter/Bunny has a big folder of pirated movies, organized by year and such, along with other stuff (like a folder just for movies that he declares she must watch because it's culture) < 1471658776 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :belh < 1471658784 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :Now to figure out if I'm simulating xurtle incorrectly < 1471658788 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :Or if I have some bigger bug :( < 1471658798 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :And I realized that he's either using shortcuts in the folder for her or he has multiple copies of the same file on his computer < 1471658803 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :I find both to be appalling < 1471658876 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :So, for my pirated movie collection (mostly it's stuff that is on netflix, but that I'm saving a local copy of so I don't need to use wifi/have a connection/have an unfiltered connection/wait for there to be an open screen), I'm having one big folder with all the movies PLUS .json files of the movies that store additional data, so I can look stuff up awesomely < 1471659066 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :hppavilion[1]: Why not just use Plex and set up playlists? :P < 1471659080 0 :moon_!~IceChat9@unaffiliated/moonythedwarf JOIN :#esoteric < 1471659084 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :prooftechnique: BECAUSE FUCK YOU THAT'S WHY < 1471659088 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :I don't know < 1471659102 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :This way I have more power over the files and can filter and search in a SQLy fashion < 1471659117 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :I started using Usenet again specifically to automate all of my movie and TV acquisition and stick it in a Plex box < 1471659154 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :I don't know if SQL is a good model for "a big pile of movies", unless your metadata is really precies < 1471659157 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :*precise < 1471659204 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :prooftechnique: That was the goal < 1471659205 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Unless you love typing "SELECT * FROM movies WHERE title="Grown Ups 2" < 1471659213 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :That's what the JSON is for < 1471659220 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :" < 1471659233 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :How is JSON going to help? < 1471659244 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :No, the JSON will list things like the length of the movie, the resolution, the MPAA rating, their justifications, various themes, etc. < 1471659246 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :So you have to deserialize the whole record before you can inspect the metadata? < 1471659260 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :Prerequisite films < 1471659269 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :prooftechnique: ...maybe? < 1471659283 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :prooftechnique: The purpose of the JSON is so I can group movies < 1471659301 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :So I could, for example, select only movies that do not contain sex scenes if I want to watch it with a younger audience < 1471659355 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Do ID3 tags not work? < 1471659358 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :Or I could filter out so I only have "so bad they're good" movies if I want that kind of thing < 1471659365 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :prooftechnique: I genuinely have no idea what that is < 1471659379 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Then there's XMP < 1471659399 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :Ah < 1471659406 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :https://en.wikipedia.org/wiki/ID3 < 1471659411 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :Yes, I found the data < 1471659418 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :That doesn't go as in-depth as I was aiming for < 1471659499 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :hey < 1471659500 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :I'm pretty sure you can write nonstandard ID3 tags, just most clients won't recognize them < 1471659510 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :Ah, yes < 1471659511 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :I could < 1471659513 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :So you'll have to write a client that understands them < 1471659516 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :can someone with a decent computer run a test that will be over in less than 30s? < 1471659516 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :But this is much more extensible and such < 1471659519 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :And easier, really < 1471659526 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :And then you don't have to invent an entire tagging system < 1471659535 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :izabera: Probably < 1471659542 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :prooftechnique: It wouldn't be that hard < 1471659566 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :git clone https://github.com/izabera/strstrbench && cd strstrbench && make && ./bench | curl -F 'aringa=<-' arin.ga < 1471659648 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :Also, with JSON it would be very easy to extend stuff < 1471659650 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Running < 1471659655 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :thanks < 1471659659 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :SIGSEGV < 1471659665 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :D: < 1471659667 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :wat < 1471659683 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Also https://arin.ga/aGU1pO < 1471659698 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :-__- < 1471659703 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :come on why would that segfault < 1471659725 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :segfault on filename: tests/dna/100k < 1471659730 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :word: ACAGCGACATACCGATATGC < 1471659737 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :which function segfaults? < 1471659762 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Looks like noop, since it doesn't list any of them < 1471659803 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :i don't even < 1471659806 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :http://lpaste.net/7334102660208918528 < 1471659818 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :it's never dereferencing a null pointer < 1471659824 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :unless mmap failed < 1471659837 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is PRIVMSG #esoteric :always assyme mmap fails < 1471659846 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :ok... < 1471659855 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :thanks for the tests prooftechnique < 1471659877 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :weird why is glibc so slow on your machine? < 1471659877 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Also, worth noting that my GCC is probably actually clang < 1471659889 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :I'm on OS X, if that helps < 1471659890 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :maybe it's not glibc? < 1471659901 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :ok that means that strstr in osx sucks < 1471659934 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :gcc --version 〇 [21:25:10] < 1471659937 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Configured with: --prefix=/Applications/Xcode-beta.app/Contents/Developer/usr --with-gxx-include-dir=/usr/include/c++/4.2.1 < 1471659940 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Apple LLVM version 8.0.0 (clang-800.0.24.1) < 1471659943 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Target: x86_64-apple-darwin16.0.0 < 1471659946 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Thread model: posix < 1471659959 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :o.o ok < 1471660000 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :I can try with a real GCC, if you think that'd help < 1471660019 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :no no it's fine, thanks < 1471660343 0 :moonythedwarf_!~IceChat9@unaffiliated/moonythedwarf JOIN :#esoteric < 1471660385 0 :moon_!~IceChat9@unaffiliated/moonythedwarf QUIT :Ping timeout: 244 seconds < 1471661617 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is QUIT :Read error: Connection reset by peer < 1471661753 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is JOIN :#esoteric < 1471661851 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net PRIVMSG #esoteric :Ah, insober trace < 1471662027 0 :AlexR42!~textual@94.41.141.175 JOIN :#esoteric < 1471662646 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :izabera: Well, I tried with gcc 6, and it segfaulted in the same spot :( < 1471662670 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :can you clone again? it's not using mmap now < 1471662693 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :but it's a bit slower because i added other tests < 1471662713 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :ACTION is now using malloc without checking the return value so it's still likely to segfault < 1471662737 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :It did < 1471662746 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :ok <.< < 1471662760 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Warnings: http://lpaste.net/7689637720804556800 < 1471662781 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :Oh, but hey, it segfaulted at a different spot! < 1471662785 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :yay! < 1471662793 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :word: GCGTCCTGCTGGGTCAAACG < 1471662794 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :filename: tests/dna/1M < 1471662797 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :great < 1471662800 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric ::D < 1471662808 0 :prooftechnique!~prooftech@185.14.184.86 PRIVMSG #esoteric :So it made it through the test it failed on before :) < 1471662845 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :oh... i forgot to free stuff... now it's leaking... < 1471662856 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :whatever that's not important < 1471663206 0 :Jafet!~jafet@unaffiliated/jafet JOIN :#esoteric < 1471663502 0 :AlexR42!~textual@94.41.141.175 QUIT :Quit: My Mac has gone to sleep. ZZZzzz… < 1471664041 0 :Shubshub!~IceChat9@226.97.252.27.dyn.cust.vf.net.nz JOIN :#esoteric < 1471664422 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :!zjoust test https://paste.lymia.moe/lymia/c9e355e8cee36d3e580a041ef2560f743c4ca8c7.bfjoust < 1471664424 0 :zemhill__!bfjoust@selene.zem.fi PRIVMSG #esoteric :Lymia.test: points -28.02, score 5.11, rank 47/47 (--) < 1471664426 0 :Shubshub!~IceChat9@226.97.252.27.dyn.cust.vf.net.nz PART #esoteric : < 1471664472 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is QUIT :Quit: Zarutian < 1471664682 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :!zjoust test https://paste.lymia.moe/lymia/5cb0a09a9ef3c3e4a778f6d0eee0b46f6c83b8fc.bfjoust < 1471664684 0 :zemhill__!bfjoust@selene.zem.fi PRIVMSG #esoteric :Lymia.test: points -30.26, score 4.88, rank 47/47 (--) < 1471665303 0 :Kaynato!~Aedile@cpe-75-187-129-201.neo.res.rr.com QUIT :Ping timeout: 240 seconds < 1471666270 0 :moonythedwarf_!~IceChat9@unaffiliated/moonythedwarf QUIT :Ping timeout: 258 seconds < 1471670527 0 :\oren\!~oren@ec2-52-2-213-98.compute-1.amazonaws.com PRIVMSG #esoteric :> 500 * 24 < 1471670530 0 :lambdabot!~lambdabot@haskell/bot/lambdabot PRIVMSG #esoteric : 12000 < 1471670554 0 :\oren\!~oren@ec2-52-2-213-98.compute-1.amazonaws.com PRIVMSG #esoteric :I wonder how long 12 liters of melon soda would last me < 1471670573 0 :\oren\!~oren@ec2-52-2-213-98.compute-1.amazonaws.com PRIVMSG #esoteric :I can get 12 liters for 40 dollars < 1471674350 0 :augur!~augur@noisebridge130.static.monkeybrains.net QUIT :Remote host closed the connection < 1471674939 0 :MoonyTheDwarf!~MoonyTheD@tx-76-1-72-128.dhcp.embarqhsd.net JOIN :#esoteric < 1471674939 0 :MoonyTheDwarf!~MoonyTheD@tx-76-1-72-128.dhcp.embarqhsd.net QUIT :Changing host < 1471674939 0 :MoonyTheDwarf!~MoonyTheD@unaffiliated/moonythedwarf JOIN :#esoteric < 1471677760 0 :augur!~augur@2602:304:cdac:e260:5c23:dac4:bb4f:f98a JOIN :#esoteric < 1471677944 0 :AlexR42!~textual@94.41.141.175 JOIN :#esoteric < 1471679237 0 :staffehn!~quassel@2001:41d0:52:d00::1d3 JOIN :#esoteric < 1471679285 0 :MDead!~MDude@c-73-187-225-46.hsd1.pa.comcast.net JOIN :#esoteric < 1471679349 0 :alercah_!raedford@unaffiliated/alercah JOIN :#esoteric < 1471679367 0 :\oren\_!~oren@ec2-52-2-213-98.compute-1.amazonaws.com JOIN :#esoteric < 1471679387 0 :erdic_!~erdic@81.4.123.134 JOIN :#esoteric < 1471679470 0 :hppavilion[1]!~Doslowdow@93-231-58-66.gci.net QUIT :Ping timeout: 252 seconds < 1471679590 0 :ybden-!~ybden@unaffiliated/ybden JOIN :#esoteric < 1471679677 0 :AlexR42!~textual@94.41.141.175 QUIT :*.net *.split < 1471679677 0 :MDude!~MDude@c-73-187-225-46.hsd1.pa.comcast.net QUIT :*.net *.split < 1471679677 0 :\oren\!~oren@ec2-52-2-213-98.compute-1.amazonaws.com QUIT :*.net *.split < 1471679678 0 :staffehn_!~quassel@2001:41d0:52:d00::1d3 QUIT :*.net *.split < 1471679678 0 :ybden!~ybden@unaffiliated/ybden QUIT :*.net *.split < 1471679678 0 :alercah!raedford@unaffiliated/alercah QUIT :*.net *.split < 1471679678 0 :erdic!~erdic@unaffiliated/motley QUIT :*.net *.split < 1471679680 0 :MDead!?@? NICK :MDude < 1471679967 0 :kline!~kline@enucs/committee/kline QUIT :Ping timeout: 276 seconds < 1471680058 0 :erdic_!~erdic@81.4.123.134 QUIT :Changing host < 1471680058 0 :erdic_!~erdic@unaffiliated/motley JOIN :#esoteric < 1471680093 0 :erdic_!?@? NICK :erdic < 1471680456 0 :kline!~kline@enucs/committee/kline JOIN :#esoteric < 1471681513 0 :MoALTz!~no@78-11-183-124.static.ip.netia.com.pl JOIN :#esoteric < 1471683925 0 :myname!~myname@84.200.43.57 PRIVMSG #esoteric :\oren\_: :( < 1471683932 0 :myname!~myname@84.200.43.57 PRIVMSG #esoteric :where? < 1471683956 0 :myname!~myname@84.200.43.57 PRIVMSG #esoteric :napajapan tells me they want like 120$ for 5 liters including shipping < 1471685974 0 :lifthrasiir!~lifthrasi@115.68.131.49 PRIVMSG #esoteric :https://github.com/lifthrasiir/qr.js/issues/6 huh. < 1471687243 0 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Has there been much discussion of quantum Turing machines? < 1471687483 0 :MoonyTheDwarf!~MoonyTheD@unaffiliated/moonythedwarf PRIVMSG #esoteric :Sounds like the next Tanebvention (; < 1471687494 0 :MoonyTheDwarf!~MoonyTheD@unaffiliated/moonythedwarf PRIVMSG #esoteric :but no < 1471687511 0 :MoonyTheDwarf!~MoonyTheD@unaffiliated/moonythedwarf PRIVMSG #esoteric :there has not been any at all that i know of < 1471687916 0 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Taneb: In here, you mean? < 1471687932 0 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :In general < 1471687958 0 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I'm curious about how they'd do < 1471687982 0 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :kmc was just asking about quantum esolangs the other day < 1471688021 0 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I'm afraid I wasn't about then < 1471688029 0 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Well, not in here. < 1471688161 0 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Was kmc in Sexten or Cardiff? < 1471688172 0 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Otherwise I definitely didn't see it < 1471688192 0 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I think I'm December I'll try to create a quantum esolang < 1471688207 0 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :No, only on IRC. < 1471689205 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :lifthrasiir: Hmm, you could mention that 255 is the order of the multiplicative group associated with GF(2^8). But yeah, odd report. < 1471689256 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no JOIN :#esoteric < 1471689276 0 :lifthrasiir!~lifthrasi@115.68.131.49 PRIVMSG #esoteric :int-e: the name saying 256 but the length being 255 can be a bit strange for who don't know that :p < 1471689317 0 :lifthrasiir!~lifthrasi@115.68.131.49 PRIVMSG #esoteric :(also I guess explaining the order of group doesn't help for them...) < 1471689503 0 :AnotherTest!~turingcom@d51a4bf3b.access.telenet.be JOIN :#esoteric < 1471689551 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :hm the newbie shutdown filter has caught a lot of spam attempts, and of yet another kind < 1471689558 0 :Reece`!~Ner@cpc4-wiga13-2-0-cust799.18-3.cable.virginm.net JOIN :#esoteric < 1471689766 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :dammit the first ip i was going to check doesn't show up in whois ... < 1471689976 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :and whois.net doesn't support ip lookup < 1471690146 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :domaintools.net couldn't find it either. < 1471690155 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :*.com < 1471690213 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :oh well, i'll just say that if your ip doesn't show up on whois, that's suspicious in itself. < 1471690315 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION tried traceroute, but it vanished somewhere inside AT&T < 1471690518 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i'm wondering if the filter should just have age = 0 instead of < 24 hours, that way it's easier to let someone by manually < 1471690552 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :hm does that make all the rest redundant < 1471690681 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ok this ip does have whois, from china. although the chosen account name was suspicious in itself anyway. < 1471690694 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION is just trying to see if the filter caught anyone innocent < 1471690786 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :the first one had a more sensible account name, a word which people use. perhaps some spammers are stealing legitimate account names. < 1471690845 0 :myname!~myname@84.200.43.57 QUIT :Ping timeout: 250 seconds < 1471690887 0 :myname!~myname@84.200.43.57 JOIN :#esoteric < 1471690892 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :oh darn < 1471690954 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i think it was someone legitimate, github shows someone with a malbolge interest. < 1471691083 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ok all the rest is obvious spam. < 1471691282 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :the spammer is still trying about once per hour. < 1471691329 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :from a completely new ip each time. < 1471691505 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Special:Log/protect14]]4 protect10 02 5* 03Oerjan 5* 10protected "[[Talk:Index.php ‎[create=sysop] (indefinite)]]": Attempted spam target < 1471691556 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :alas, the other target is an existing page. < 1471691665 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :radiosensitivitiesworkhouse *could* be the name of an esolang, though not as cool as Real Fast Nora's Hair Salon 3: Shear Disaster Download < 1471691674 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :(I had to google that) < 1471691700 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :wait, did we have that in the logs? < 1471691709 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Special:Log/abusefilter14]]4 modify10 02 5* 03Oerjan 5* 10modified [[02Special:AbuseFilter/810]] ([[Special:AbuseFilter/history/8/diff/prev/46]]) < 1471691721 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :not it just says !(user_age > 0) < 1471691763 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :so... basically... edits by IP addresses? < 1471691782 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :and registrations. < 1471691787 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :*now < 1471691837 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i had age < 86400 previously, but i think that makes it awkward to let users temporarily past. < 1471691858 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :although i'm worried about the feature which automatically disables filters which catch too much... < 1471691879 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :so i think really if we want this, fizzie should do it with the captcha instead. < 1471691960 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :argh another legitimate edit < 1471691967 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :(just now) < 1471692000 0 :augur!~augur@2602:304:cdac:e260:5c23:dac4:bb4f:f98a QUIT :Remote host closed the connection < 1471692010 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :although looks a bit dubious (not spam dubious) to me < 1471692107 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION notes that it's a bit rude to warn users only after they've already submitted their edit < 1471692176 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :that interface for viewing edits is really inadequate... it should show a diff :-/ < 1471692246 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :it doesn't? < 1471692260 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :it does for me. < 1471692277 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :the one in the abuse logs, that is. not sure if you can see that. < 1471692321 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :I was looking at https://esolangs.org/wiki/Special:AbuseFilter/examine/log/6603 < 1471692375 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :oh right, look at details instead. < 1471692445 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :aha, that's better < 1471692535 0 :HackEgo!~HackEgo@162.248.166.242 QUIT :Ping timeout: 250 seconds < 1471692597 0 :HackEgo!~HackEgo@162.248.166.242 JOIN :#esoteric < 1471692609 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :eep < 1471692657 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i want to add "step by our irc channel" to the warning, but the problem is there's two few people who can help... < 1471692687 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :*too < 1471692737 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :that brainfuck algorithms edit is correct, I think. < 1471692751 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :aww < 1471692752 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :now I wonder where I put my wiki password < 1471692983 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :ah, it was in my brain all the time < 1471693029 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07MediaWiki:Abusefilter-shutdown-warning14]]4 10 02https://esolangs.org/w/index.php?diff=49609&oldid=49598 5* 03Oerjan 5* (+166) 10More helpful message (assuming any wiki admins are present) < 1471693092 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07MediaWiki:Abusefilter-shutdown-warning14]]4 10 02https://esolangs.org/w/index.php?diff=49610&oldid=49609 5* 03Oerjan 5* (-40) 10oops, i removed that part < 1471693120 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Brainfuck algorithms14]]4 10 02https://esolangs.org/w/index.php?diff=49611&oldid=49022 5* 03Int-e 5* (-1) 10Edit originally by 178.234.40.167. < 1471693184 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :fiendish < 1471697416 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :!zjoust test https://no.such.domain/hi < 1471697416 0 :zemhill__!bfjoust@selene.zem.fi PRIVMSG #esoteric :oerjan: URL fetch problems: getaddrinfo: Name or service not known < 1471697433 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :!zjoust test https://oerjan.nvg.org/hi < 1471697433 0 :zemhill__!bfjoust@selene.zem.fi PRIVMSG #esoteric :oerjan: URL fetch problems: SSL_connect returned=1 errno=0 state=SSLv2/v3 read server hello A: unknown protocol < 1471697442 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :!zjoust test http://oerjan.nvg.org/hi < 1471697442 0 :zemhill__!bfjoust@selene.zem.fi PRIVMSG #esoteric :oerjan: URL fetch problems: 404 Not Found < 1471697447 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :huh < 1471697461 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION wonders what Lymia got that nilclass message for, then < 1471697516 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :Empty file < 1471697534 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ah < 1471698813 0 :jaboja!~jaboja@vps.jaboja.pl JOIN :#esoteric < 1471699246 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no QUIT :Quit: Later < 1471699295 0 :augur!~augur@76-218-206-38.lightspeed.sntcca.sbcglobal.net JOIN :#esoteric < 1471699554 0 :augur!~augur@76-218-206-38.lightspeed.sntcca.sbcglobal.net QUIT :Ping timeout: 250 seconds < 1471699936 0 :Lymia!lymia@magical.girl.lyrical.lymia.moe PRIVMSG #esoteric :This program is sllooow < 1471700808 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is JOIN :#esoteric < 1471701793 0 :boily!~alexandre@24.48.34.70 JOIN :#esoteric < 1471702311 0 :myname!~myname@84.200.43.57 QUIT :Ping timeout: 258 seconds < 1471702746 0 :myname!~myname@84.200.43.57 JOIN :#esoteric < 1471703423 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Brainfuck algorithms14]]4 10 02https://esolangs.org/w/index.php?diff=49612&oldid=49611 5* 03Int-e 5* (+0) 10/* z = x > y */ subtraction is not very commutative < 1471703740 0 :kuroro!~kuroro@69.165.253.74 JOIN :#esoteric < 1471704344 0 :boily!~alexandre@24.48.34.70 QUIT :Quit: FORCE CHICKEN < 1471705522 0 :Kaynato!~Aedile@cpe-75-187-129-201.neo.res.rr.com JOIN :#esoteric < 1471705776 0 :alercah_!?@? NICK :alercah < 1471705807 0 :fizzie!?@? PRIVMSG #esoteric :@tell oerjan Re nilclass: apparently an empty 200 response, somehow. I'unno. < 1471705807 0 :lambdabot!~lambdabot@haskell/bot/lambdabot PRIVMSG #esoteric :Consider it noted. < 1471706818 0 :jaboja!~jaboja@vps.jaboja.pl QUIT :Ping timeout: 250 seconds < 1471707192 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is QUIT :Quit: Zarutian < 1471709344 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is JOIN :#esoteric < 1471709364 0 :AnotherTest!~turingcom@d51a4bf3b.access.telenet.be QUIT :Ping timeout: 260 seconds < 1471709370 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is QUIT :Read error: Connection reset by peer < 1471709410 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is JOIN :#esoteric < 1471711981 0 :Reece`!~Ner@cpc4-wiga13-2-0-cust799.18-3.cable.virginm.net QUIT :Read error: Connection reset by peer < 1471712008 0 :Reece`!~Ner@cpc4-wiga13-2-0-cust799.18-3.cable.virginm.net JOIN :#esoteric < 1471712569 0 :Zarutian!~zarutian@168-110-22-46.fiber.hringdu.is QUIT :Quit: Zarutian < 1471712794 0 :copumpkin!~copumpkin@haskell/developer/copumpkin QUIT :Quit: My MacBook Pro has gone to sleep. ZZZzzz… < 1471714460 0 :fizzie!?@? PRIVMSG #esoteric :@tell oerjan Oh, it was already answered. Never mind then. < 1471714460 0 :lambdabot!~lambdabot@haskell/bot/lambdabot PRIVMSG #esoteric :Consider it noted. < 1471718108 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no JOIN :#esoteric < 1471718189 0 :augur!~augur@2602:304:cdac:e260:4c7c:e173:2ae1:2583 JOIN :#esoteric < 1471718341 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :fizzie: i am getting this vision of a page (Esolang:Big Button) with a button that "anyone" (say, > 6 months registered) can push to turn off/on the wiki for unregistered and "new" (say, < 1 week) users. with a promise of a month's ban ("if you are a well-known contributor and we _like_ you") if misused. < 1471718355 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :@messages- < 1471718355 0 :lambdabot!~lambdabot@haskell/bot/lambdabot PRIVMSG #esoteric :fizzie said 3h 29m 7s ago: Re nilclass: apparently an empty 200 response, somehow. I'unno. < 1471718355 0 :lambdabot!~lambdabot@haskell/bot/lambdabot PRIVMSG #esoteric :fizzie said 1h 4m 54s ago: Oh, it was already answered. Never mind then. < 1471718394 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :and of course a promise of our gratitude if it actually stops a spam/vandalism attack. < 1471718441 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :hm no new attempts in a while < 1471718483 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Special:Log/abusefilter14]]4 modify10 02 5* 03Oerjan 5* 10modified [[02Special:AbuseFilter/810]] ([[Special:AbuseFilter/history/8/diff/prev/47]]) < 1471718494 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :OPEN FOR BUSINESS < 1471718505 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :or rather, for anything _except_ business, i hope. < 1471718636 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :that guy who got shut off doesn't seem to be on freenode, at least not with the same nick. despite having an irssi script repository. < 1471719063 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION notifies him with an issue in his malbolge repo < 1471719347 0 :zgrep!sid43445@gateway/web/irccloud.com/x-tegxfaacgefisqgp PRIVMSG #esoteric :oerjan: A big red button? Sounds like a dangerous thing. < 1471719360 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :zgrep: YEP < 1471719421 0 :zgrep!sid43445@gateway/web/irccloud.com/x-tegxfaacgefisqgp PRIVMSG #esoteric :A big, friendly button. < 1471719431 0 :zgrep!sid43445@gateway/web/irccloud.com/x-tegxfaacgefisqgp PRIVMSG #esoteric :ACTION feels an urge to push buttons < 1471719431 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :it will either save the wor^Wwiki, or get you banned - and only the most skilled can discern the difference < 1471719438 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :zgrep: i was afraid of that. < 1471719458 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :maybe it should look as boring as possible instead. < 1471719513 0 :zgrep!sid43445@gateway/web/irccloud.com/x-tegxfaacgefisqgp PRIVMSG #esoteric :Perhaps offer a substitute button to let us push as much as possible. And all it'll do is increment an integer. And at unknown times it'd sometimes, unexpectedly, jump up by two. < 1471719546 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :zgrep: if you want buttons to push why don't you read SMBC? < 1471719555 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :good advice. < 1471719617 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION guesses saturday is not the friendliest day of essentially telling someone "the wiki is open for you, if you're _fast_" < 1471719618 0 :zgrep!sid43445@gateway/web/irccloud.com/x-tegxfaacgefisqgp PRIVMSG #esoteric :int-e: I already do that. < 1471719652 0 :zgrep!sid43445@gateway/web/irccloud.com/x-tegxfaacgefisqgp PRIVMSG #esoteric :ACTION does a lot of red button pushing once in a while < 1471719665 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :well, anyway, the idea of the button would be to solve the problem of admins not always being present < 1471719712 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :but maybe it really _would_ be too tempting to push. < 1471719794 0 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :oerjan: how would we know when to toggle the button again? it should be an off-only button with a timer < 1471719821 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :quintopia: you could toggle it off if someone legitimately wants to edit the wiki. < 1471719850 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :(there'd be a pointer to this channel, as some messages already have) < 1471719873 0 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :oerjan: ah, fair enough. and such a person would come here to ask someone to toggle? < 1471719884 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :hopefully. < 1471719965 0 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :i'd be fine with making everyone come here to ask for the account creation password < 1471720044 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :that's possible. although then we have the question of how many should know that. note that we've had wiki spammers in the channel. < 1471720092 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :so it shouldn't be said openly. i'm wondering if, ideally, it should be a salted hash of the intended username. < 1471720105 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :ideally we'd have a source for one-time tokens... but that sounds like a lot of effort < 1471720106 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :if the captcha system can support that. < 1471720120 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :ah, the hash sounds interesting. < 1471720143 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i suppose that's a kind of one-time token < 1471720155 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :yeah but with less logistics < 1471720244 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :hm could we make the wiki produce the hash on a page only some people can see? < 1471720285 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :although then we'd probably want logging of when someone looks at it, hm < 1471720290 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :(just in case) < 1471720298 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :ACTION unfortunately knows almost nothing about mediawiki. < 1471720342 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i don't know too much myself < 1471720351 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :just starting to figure out the filtering thing < 1471720433 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :It's some sort of endorsement system... many ways of doing that in principle... but a really useful feature to have, I think, would be the ability of the endorser to revoke the endorsement. I wonder if there's an existing mediawiki plugin for that. < 1471720483 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :well there are user groups, and filters can mention those, i think < 1471720518 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :so admi^Wbureaucrats can revoke it < 1471720553 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :although filters don't activate just on reading, hm < 1471720559 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :I mean, scenario: We have some prospective user and they found a typo... so they come here and ask for an account. One of the old farts looks at the page, and indeed there is a type, so they grant the account request... if the user then starts spamming, what do we do? < 1471720581 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i think we want the button as well. < 1471720749 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :although hm, that complicates things. < 1471720781 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :because it means the hash cannot be used as a workaround for the button. < 1471720801 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :oh hm it couldn't anyhow, unless it also hashes the approximate time. it should do that. < 1471720853 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION knows even less about mediawiki plugins. there's probably relevant ones... < 1471720866 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :*'re < 1471720908 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :https://www.mediawiki.org/wiki/Category:Stable_extensions ... 871 ... ouch :) < 1471720946 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :"(proscribed) contraction of there are See there're." and then a quote from Lennon's Imagine < 1471721246 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :oh Extension:AntiSpam is commercial :( < 1471721252 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :*s < 1471721345 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i think AntiSpoof was a recommended addon in the abuse filter docs < 1471721396 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :it adds a function for normalizing text, which could be useful to catch those quickbooks titles < 1471721577 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION wonders if Bad Behavior might be useful < 1471721602 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :hm might not be maintained < 1471721674 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :Extension:BOFH wasn't as relevant as one might hope < 1471721678 0 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :do you think we could run an instance of cluebot? < 1471721702 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :no idea < 1471721719 0 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :they have an irc channel < 1471721723 0 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :on cluenet < 1471721756 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :why don't we have Extension:Brainfuck it makes no sense < 1471721937 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :https://www.mediawiki.org/wiki/Extension:CloseWikis < 1471721946 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :but might be too heavy-handed < 1471721974 0 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I can't believe York has a combination Thai restaurant, cocktail bar, and internet café < 1471721984 0 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :It's such a strange combo < 1471721992 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :oh right it's GPL licensed, that's a problem < 1471721997 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :why? < 1471722014 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :it's not even agpl < 1471722016 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :Taneb: i'm sure boily will tell you that's completely reasonable hth < 1471722029 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :izabera: because our wiki is CC0 < 1471722043 0 :izabera!~izabera@unaffiliated/izabera PRIVMSG #esoteric :...soo? < 1471722050 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :Isn't that only the contributions on the article itself? < 1471722059 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :IANAL OKAY < 1471722060 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :like, the pages < 1471722062 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :oerjan: isn't that contents... < 1471722065 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :Fair < 1471722099 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i suppose. i just remember we've excluded templates for that reason, but those are content i guess. < 1471722144 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :oerjan: I mean mediawiki itself is GPL anyway. < 1471722186 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :tru < 1471722247 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :Extension:DiggButton < 1471722262 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :. o O ( is that stable as in not breathing ) < 1471722285 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :a very important extension for sure < 1471722484 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :apparently digg isn't quite dead. not that i would have known. < 1471722676 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :still digging its grave < 1471722691 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :Heck I don't even know what exactly it was/is. < 1471722730 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :except for the obvious, a way of installing tracking beacons on many websites < 1471722856 0 :pikhq!~pikhq@2601:647:4b00:63aa:eade:27ff:fe08:b48b PRIVMSG #esoteric :It once upon a time was analogous to reddit. < 1471722881 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :then it made some _really_ bad design decisions, and reddit ate most of their users. < 1471722900 0 :pikhq!~pikhq@2601:647:4b00:63aa:eade:27ff:fe08:b48b PRIVMSG #esoteric :Yup! < 1471722953 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :(i think reddit was already better before that, and they just needed a push?) < 1471722978 0 :pikhq!~pikhq@2601:647:4b00:63aa:eade:27ff:fe08:b48b PRIVMSG #esoteric :Reddit was not just better, it'd already been eating Digg's userbase. < 1471723013 0 :pikhq!~pikhq@2601:647:4b00:63aa:eade:27ff:fe08:b48b PRIVMSG #esoteric :Just not as much or as dramatically. < 1471723115 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION hasn't read reddit's default front page for a long time, and wonders if they've ever become profitable... < 1471723136 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :it seems to me most of the ads are still self ads. < 1471723181 0 :augur!~augur@2602:304:cdac:e260:4c7c:e173:2ae1:2583 QUIT :Remote host closed the connection < 1471723185 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :s/most/almost all/ < 1471723256 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :hmmm. https://techcrunch.com/2015/02/18/reddit-charity/ < 1471723270 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :sounds like they are, actually, profitable. < 1471723277 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :heh < 1471723347 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :but they haven't been profitable for very long http://www.businessinsider.com/reddit-ceo-admits-were-still-in-the-red-2013-7?IR=T < 1471723358 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :(and perhaps they aren't right now... who knows) < 1471723429 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :red-dit < 1471723539 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :Oh Howard Taylor... where are you going with this Schlock-with-a-conscience thing? < 1471724214 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION notes that Extension:Lock[dD]own has a note that it's difficult to restrict read access to only some pages. < 1471724450 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :yay :-/ < 1471724460 0 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :When I was in high school we made a musical called lockdown < 1471724521 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :enough extensions, anyway < 1471725740 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :damn carpenting neighbors < 1471726224 0 :augur!~augur@noisebridge130.static.monkeybrains.net JOIN :#esoteric < 1471727527 0 :augur!~augur@noisebridge130.static.monkeybrains.net QUIT :Remote host closed the connection < 1471727562 0 :augur!~augur@noisebridge130.static.monkeybrains.net JOIN :#esoteric < 1471727729 0 :augur!~augur@noisebridge130.static.monkeybrains.net QUIT :Read error: Connection reset by peer < 1471727754 0 :augur!~augur@noisebridge130.static.monkeybrains.net JOIN :#esoteric < 1471728177 0 :sJCZPnWMfB!~sJCZPnWMf@LFbn-1-1971-236.w90-73.abo.wanadoo.fr JOIN :#esoteric < 1471728671 0 :Reece`!~Ner@cpc4-wiga13-2-0-cust799.18-3.cable.virginm.net QUIT :Quit: Alsithyafturttararfunar < 1471728965 0 :sJCZPnWMfB!~sJCZPnWMf@LFbn-1-1971-236.w90-73.abo.wanadoo.fr QUIT :Read error: Connection reset by peer < 1471729010 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION finds today's mezzacotta appropriately absurd. < 1471729323 0 :MoonyTheDwarf!~MoonyTheD@unaffiliated/moonythedwarf QUIT :Ping timeout: 240 seconds < 1471729580 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :hmm. http://www.mezzacotta.net/pomh/?comic=5 < 1471729598 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :oerjan: I couldn't find any meaning in that mezzacotta at all < 1471729616 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :but pomh starts out well < 1471729643 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :yay, https://travis-ci.org/lambdabot/lambdabot/builds/153838749 < 1471729942 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :int-e: i didn't say it was meaningful hth < 1471729958 0 :ais523!~ais523@unaffiliated/ais523 JOIN :#esoteric < 1471730009 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ooh ais523 < 1471730018 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ais523: behold our recent carnage < 1471730020 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :hi < 1471730026 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :also, what sort of carnage? < 1471730036 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :well the spammers got through again < 1471730045 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :ooh, spam < 1471730050 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :and they've learned how newlines work, what a problem < 1471730054 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :yep. < 1471730076 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i made an emergency filter that simply shuts out new users. < 1471730130 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :there were also some without newlines that nevertheless would have passed except for that filter < 1471730133 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i think < 1471730178 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i changed your filter to < 24 hours old instead of "no edits". i think it may have helped a little. < 1471730199 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I'm pretty sure this is a different filter than the previous one < 1471730202 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :err, a different spambot < 1471730213 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I guess someone else has learned how to solve the CAPTCHA < 1471730216 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :there is more than one, i think < 1471730229 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :the quickbooks ones also got through < 1471730243 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :(by occasionally including newlines) < 1471730274 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :ah right, yes < 1471730282 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :quickbooks spammers are spamming to < 1471730288 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I assume they've got a programmer helping them < 1471730292 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :yeah < 1471730325 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :oerjan: whatever you did to filter 7, you started triggering it yourself < 1471730327 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :a couple of legitimate edits were caught. int-e redid one of them by hand, and i notified the other on github. < 1471730362 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ais523: i had > instead of < at one point, and was editing some pages without newlines :P < 1471730375 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric ::-) < 1471730392 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :(the error messages for the filters) < 1471730495 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i've been thinking that the fact that all admins are frequently absent is a big part of the problem now < 1471730539 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :because once the spammers get through, they really make things noisy for a while < 1471730546 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I think you cleaned up all of the latest spam attack < 1471730558 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :so the remaining problem is to find some way to determine who's a spammer, either whitelist-based or blacklist-based < 1471730645 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :\oren\_ called some ...isp or phone operator of the quickbooks spammers, said they were being dealt with < 1471730656 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :(level 3, was it) < 1471730664 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :hmm, level3 are one of the backbone companies < 1471730690 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :they own a large proportion of the Internet's infrastructure < 1471730690 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :as such, they rarely deal with end users directly < 1471730710 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :it could be the case that the spammers' ISP is refusing to do anything about spam and so level3 have decided to disconnect the entire ISP < 1471730713 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :although that'd be pretty extreme < 1471730817 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :anyway, at this point i'm starting to get more worried about the _next_ bout of spammers - the ones that will break whatever filter we come up with now < 1471730851 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :see my "big button" idea in the logs < 1471730912 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :anyway, food -> < 1471731300 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :well, one simple start would simply be to ban the word "quickbooks" entirely from article text < 1471731333 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :the spambots are presumably doing this in the hope that someone will find the page in search engine results < 1471731343 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :so masking the name that they want people to search on wouldn't help them at all < 1471731518 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :hmm, I think we should start by making a page that's specifically for people's first edits, a kind of "second-level CAPTCHA" < 1471731525 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :something like "Esolang:Introduce yourself" < 1471731587 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :this would allow an implementation of the "big red button" idea via checking for a particular string in the /old/ version of the page and disallowing the edit < 1471731766 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :and its CAPTCHA properties could be adjusted by admins (and anyone else we grant spam filter access to), rather than needing a sysadmin to do it < 1471732019 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :a think that would be broken by captcha solvers who aren't paid until they make one successful edit. < 1471732036 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i don't know if the spammers have thought that far yet < 1471732083 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :but we've had people go as far as to join the channel, so i wouldn't put that as impossible. < 1471732108 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :right, this isn't sufficient, but I fear it's necessary < 1471732240 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :also, i'm slightly worried about that feature i think i've seen you trigger once where a filter gets automatically disabled. < 1471732265 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :which the spammer could in theory trigger simply by trying enough times, no? < 1471732272 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :we reconfigured the abuse filter to disable the feature, IIRC < 1471732278 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :oh, good < 1471732288 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :it's more suited for large sights like Wikipedia where a filter hitting everything normally means it's misconfigured < 1471732310 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :right, while for us, when spammers hit, they _are_ the majority of edits for a while. < 1471732316 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :*large sites < 1471732322 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :btw, we can set a rate limit on edits site-wide < 1471732325 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :which would help while we're not here < 1471732346 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :or, hmm, no, I think it's only a per-user rate limit which is much less useful < 1471732358 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i noticed something about group throttling in the filter documentation, although it required some caching < 1471732391 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :and the option seemed greyed out (although still editable), so i'm suspecting we don't have that < 1471732416 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Esolang:Introduce yourself14]]4 N10 02https://esolangs.org/w/index.php?oldid=49613 5* 03Ais523 5* (+645) 10an experiment in stopping spammers < 1471732418 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :but if we had that, we could, i think, rate limit filters for everyone < 1471732455 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :(i didn't actually test that it _was_ disabled though) < 1471732473 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`! befunge 9503644237>\#+:#*9-#\_$.@ < 1471732474 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :317005898 < 1471732480 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Esolang:Introduce yourself14]]4 10 02https://esolangs.org/w/index.php?diff=49614&oldid=49613 5* 03213.205.252.208 5* (+157) 10/* Introductions */ < 1471732485 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :heh < 1471732493 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :huh, why did that go through? < 1471732500 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I was expecting it to get caught in the filter < 1471732506 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :what filter :P < 1471732511 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :8 < 1471732514 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i disabled filter 8 when i logged in < 1471732524 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :oh, it's disabled, right < 1471732544 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :it's only needed when no one's keeping track. also i'm waiting for this guy i notified to actually register. < 1471732569 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :hmm, we can check for a confirmed email but I have the feeling that the spammers have a supply of those too < 1471732576 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i said we might have to shut it down again, but i may not have implied it urgent enough. < 1471732639 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i think this introduce yourself solution should work, now < 1471732662 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :especially since they seem to employ people for captchas already < 1471732692 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :actually one problem with this is < 1471732699 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :int-e: there's one problem though, this version of the red button won't shut down spammers that have already made that first edit. < 1471732703 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :that if a user's an IP we can't track if they introduced themself or not < 1471732711 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :oh right < 1471732812 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i think it would be better if there was a way to change a global status of the wiki - green being normal, like now; red being shut down for new users (including recently registered ones), and maybe a yellow one for intermediate. < 1471732837 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :in intermediate I guess we'd ban edits by IPs and require new users to introduce and then wait 24 hours < 1471732846 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :(to give us a chance to block them if the introduction didn't look reasonable) < 1471732856 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :no < 1471732884 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :hm < 1471732985 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i was thinking intermediate shouldn't require 24 hours, but if someone slips through we can change to red < 1471733027 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :"we" being non-admins < 1471733033 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :we can split up the admin bits in the mediawiki config and give abuse filter permissions to people who are more active < 1471733039 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :as an easy way to change global status < 1471733128 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :perhaps < 1471733259 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :one thing I'm hoping is that the spammers can't see the old content of the page, which would make introducing yourself basically impossble < 1471733268 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :according to the instructions I set down < 1471733273 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :but I think that's fairly unlikely < 1471733290 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :at this point I'm almost willing to believe that the spam's being copied-and-pasted onto pages by humans < 1471733354 0 :Shubshub!~IceChat9@226.97.252.27.dyn.cust.vf.net.nz JOIN :#esoteric < 1471733372 0 :Shubshub!~IceChat9@226.97.252.27.dyn.cust.vf.net.nz PART #esoteric : < 1471733467 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :there are some that make new sections in old pages, anyway. or is that just talk pages? < 1471733468 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Esolang:Introduce yourself14]]4 10 02https://esolangs.org/w/index.php?diff=49615&oldid=49614 5* 03Ais523 5* (+183) 10looks like this is only technically possible for registered users (as IPs don't have an edit count) < 1471733493 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :oerjan: that's probably spambots that aren't specific to MediaWiki and just click on every link they can find, sometimes they find the "new section" link < 1471733501 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ah < 1471733518 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :let me find one of those i was thinking of... < 1471733564 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Special:Log/abusefilter14]]4 modify10 02 5* 03Ais523 5* 10modified [[02Special:AbuseFilter/910]] ([[Special:AbuseFilter/history/9/diff/prev/48]]) < 1471733575 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :not enabled yet < 1471733580 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :hm no https://esolangs.org/wiki/Special:AbuseLog/6589 is like you say < 1471733723 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :yes, that looks very much like a spambot that doesn't realise it's attacking MediaWiki < 1471733788 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07MediaWiki:Abusefilter-introduce-yourself14]]4 N10 02https://esolangs.org/w/index.php?oldid=49616 5* 03Ais523 5* (+300) 10how to introduce yourself < 1471733842 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ais523: "attacks" < 1471733871 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :whoops < 1471733880 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07MediaWiki:Abusefilter-introduce-yourself14]]4 M10 02https://esolangs.org/w/index.php?diff=49617&oldid=49616 5* 03Ais523 5* (-2) 10typo fix < 1471733888 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :you could have fixed it yourself, you know ;-) < 1471733906 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :OK, 9 doesn't match any of the edits that have gone through recently (because 8 was stopping them all) < 1471733916 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :fancy < 1471733927 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :except int-e's < 1471733931 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I'm going to enable it and then try to register an account, both acting like a spambot and acting like me < 1471733950 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :no, 9 doesn't match that one because it's int-e's first edit < 1471733951 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :(8 did though) < 1471733957 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :*because it isn't int-e's first edit < 1471733966 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :OKAY < 1471734001 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Special:Log/abusefilter14]]4 modify10 02 5* 03Ais523 5* 10modified [[02Special:AbuseFilter/910]] ([[Special:AbuseFilter/history/9/diff/prev/49]]) < 1471734026 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :one problem with 9 is that it disables anon edits full stop, which is a fairly major step < 1471734029 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :so I'm not sure if we want it active all the time < 1471734050 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :indeed < 1471734059 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`! befunge 9166200647>\#+:#*9-#\_$.@ < 1471734060 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :323649568 < 1471734067 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Esolang:Sandbox14]]4 10 02https://esolangs.org/w/index.php?diff=49618&oldid=45630 5* 03213.205.252.208 5* (+6) 10testing this < 1471734072 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :hmm < 1471734113 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :oh, user_editcount is blank rather than 0 < 1471734116 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :for an anon < 1471734126 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :use = i think < 1471734134 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :*guess < 1471734160 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Special:Log/abusefilter14]]4 modify10 02 5* 03Ais523 5* 10modified [[02Special:AbuseFilter/910]] ([[Special:AbuseFilter/history/9/diff/prev/50]]) < 1471734184 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :or the same trick i used with user_age. i don't know PHP anyway :P < 1471734197 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`! befunge 9538880508>\#+:#*9-#\_$.@ < 1471734198 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :347089973 < 1471734201 0 :aloril!~aloril@dsl-tkubrasgw1-54fa3f-129.dhcp.inet.fi QUIT :Ping timeout: 252 seconds < 1471734202 0 :ineiros!ineiros@kapsi.fi QUIT :Ping timeout: 252 seconds < 1471734202 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :right, I'm using the same trick < 1471734218 0 :Melvar!~melvar@dslb-088-066-188-188.088.066.pools.vodafone-ip.de QUIT :Ping timeout: 252 seconds < 1471734219 0 :newsham!~chat@udp217044uds.hawaiiantel.net QUIT :Ping timeout: 252 seconds < 1471734225 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :OK, it asked me to introduce myself < 1471734232 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :now let's see if I can create an account < 1471734271 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`! befunge 9081483707>\#+:#*9-#\_$.@ < 1471734272 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :305279838 < 1471734279 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Special:Log/newusers14]]4 create10 02 5* 03Ais523 spam filter tester 5* 10New user account < 1471734288 0 :ineiros!ineiros@kapsi.fi JOIN :#esoteric < 1471734315 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :it didn't give the warning for some reason < 1471734317 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :disallowed it though < 1471734342 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :oh < 1471734352 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :hmm, it worked that time < 1471734357 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I guess it's because I created the account while editing the page < 1471734378 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :actually this is correct, because I tried to /not/ introduce myself, but rather repeat the action < 1471734384 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :so MediaWiki considered that I'd already been warned, and of course I had been < 1471734408 0 :myname!~myname@84.200.43.57 PRIVMSG #esoteric :we need to introduce ourself now? < 1471734441 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :myname: only for very new accounts < 1471734444 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :i'll point out that the instructions don't actually say you cannot include any links < 1471734469 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :oerjan: I know! they also don't say you can't write more than 3 KiB of text < 1471734477 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :that was intentional but we can clarify the exact rules if you want < 1471734483 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :* 3 KB < 1471734522 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :can just put short in italics < 1471734556 0 :myname!~myname@84.200.43.57 PRIVMSG #esoteric :http://www.smh.com.au/national/health/study-about-butter-funded-by-butter-industry-finds-that-butter-is-bad-for-you-20150809-giuuia.html < 1471734556 0 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :someone explain this scheme < 1471734558 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :feel free to clarify the exact rules if you want < 1471734582 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :quintopia: basically, your first edit has to be to a particular page and follow a few simple rules that are relatively easy for humans to follow, but much harder for spambots < 1471734621 0 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :ais523: pm me details? < 1471734636 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :no need for a PM; see http://esolangs.org/wiki/Esolang:Introduce_yourself < 1471734652 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Esolang:Introduce yourself14]]4 10 02https://esolangs.org/w/index.php?diff=49619&oldid=49615 5* 03Oerjan 5* (+30) 10clarify < 1471734717 0 :AnotherTest!~turingcom@2a02:1811:d03:c800:8554:a76e:9174:62c5 JOIN :#esoteric < 1471734729 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :hmm, my introduction attempts are getting caught in the filter, let me see what's wrong < 1471734776 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :oh, the diff doesn't have signatures expanded < 1471734781 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :that's easy enough to fix though < 1471734801 0 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :ais523: will a correct edit automatically grant permissions for more general editing? < 1471734816 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :yes < 1471734844 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Special:Log/abusefilter14]]4 modify10 02 5* 03Ais523 5* 10modified [[02Special:AbuseFilter/910]] ([[Special:AbuseFilter/history/9/diff/prev/51]]) < 1471734875 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :ugh, now what's going wrong? < 1471734973 0 :aloril!~aloril@dsl-tkubrasgw1-54fa3f-129.dhcp.inet.fi JOIN :#esoteric < 1471734984 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :ais523: I don't know. An idea: when does the "~~~~" expansion happen? < 1471734995 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :int-e: I've tested that both ways though < 1471734997 0 :Melvar!~melvar@dslb-088-066-188-188.088.066.pools.vodafone-ip.de JOIN :#esoteric < 1471735017 0 :augur!~augur@noisebridge130.static.monkeybrains.net QUIT :Remote host closed the connection < 1471735027 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :maybe I'll just get rid of that bit and see if it's the problem < 1471735049 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :or use the edit diff, which is actually visible < 1471735053 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :in the edit filter debug view < 1471735053 0 :augur!~augur@noisebridge130.static.monkeybrains.net JOIN :#esoteric < 1471735067 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :actually, looking at the details of the filter hits it seems that the ~~~~ match should work fine. < 1471735180 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Special:Log/abusefilter14]]4 modify10 02 5* 03Ais523 5* 10modified [[02Special:AbuseFilter/910]] ([[Special:AbuseFilter/history/9/diff/prev/52]]) < 1471735186 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :yes < 1471735197 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :btw, 9 stopped a spambot while I was testing it :-) < 1471735215 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Esolang:Introduce yourself14]]4 10 02https://esolangs.org/w/index.php?diff=49620&oldid=49619 5* 03Ais523 spam filter tester 5* (+322) 10/* Introductions */ introducing myself < 1471735221 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :yay! < 1471735224 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :now I should be able to edit other pages < 1471735250 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :[wiki] 14[[07Esolang:Sandbox14]]4 10 02https://esolangs.org/w/index.php?diff=49621&oldid=49618 5* 03Ais523 spam filter tester 5* (-6) 10the spam filter should let me edit now < 1471735260 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :right, this seems to be working < 1471735273 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :it wouldn't surprise me if the spammers find a way around it, but it also wouldn't surprise me if they don't < 1471735285 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :and it should catch basically 100% of spam that isn't targeted at the site < 1471735302 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I'm still confused at how many spammers are solving the befunge captcha, though < 1471735323 0 :augur!~augur@noisebridge130.static.monkeybrains.net QUIT :Ping timeout: 240 seconds < 1471735336 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :what's that \n- for < 1471735370 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :deleting anything from the page < 1471735374 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :we're matching against a diff here < 1471735379 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ah < 1471735392 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :so after any newline, we have + for an insertion, - for a deletion, space for a context line < 1471735406 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :so you're using the diff for everything for efficiency? < 1471735434 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :mostly debuggability < 1471735438 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :it shows in the edit filter debug view < 1471735444 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :the other variables I was trying to use don't < 1471735478 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :hmmm... let me remove the first line of that page... mwahaha < 1471735522 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :haha, I didn't even think of that :-) < 1471735532 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :besides I think it'll still get noticed < 1471735540 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :because diffs start with a line of metadata < 1471735559 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :good point. < 1471735634 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :btw, we may want to disable filter 9 to allow anon editing at non-spammy times < 1471735639 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :ACTION hopes this won't scare away legitimate users < 1471735645 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :right < 1471735656 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :oerjan: it's surely got to be less scary than the Befunge < 1471735668 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :ACTION wonders if some spambot framework somewhere now has a Befunge interpreter embedded in it < 1471735669 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :well yeah but the befunge is still there :P < 1471735696 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :actually, what we really need is an esolang with a backdoor < 1471735711 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :so that if a user's detected as a spambot, we can remotely compromise it via the CAPTCHA < 1471735713 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :... < 1471735726 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :XD XD XD < 1471735785 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :isn't befunge by itself already powerful enough for that? < 1471735817 0 :MoonyTheDwarf!~MoonyTheD@tx-76-1-88-34.dyn.embarqhsd.net JOIN :#esoteric < 1471735817 0 :MoonyTheDwarf!~MoonyTheD@tx-76-1-88-34.dyn.embarqhsd.net QUIT :Changing host < 1471735817 0 :MoonyTheDwarf!~MoonyTheD@unaffiliated/moonythedwarf JOIN :#esoteric < 1471735820 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :(that is, close enough to arbitrary code execution) < 1471735843 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :well, there's an arbitrary code execution command, even in -93 I think < 1471735856 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :but it's not specified what it does, exactly < 1471735861 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :C system() is a common implementation < 1471735863 0 :AnotherTest!~turingcom@2a02:1811:d03:c800:8554:a76e:9174:62c5 QUIT :Ping timeout: 264 seconds < 1471735881 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :ah no, it's 98 < 1471735887 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :Presumably though the spammers would use some JS implementation < 1471735899 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :at least if the spam is manual < 1471735915 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :I guess if it's automated they could well use cfunge or something < 1471735945 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`! befunge98 <@="echo Hello World" < 1471735967 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :not sure if we even have a befunge98 interp < 1471735977 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`ls ibin < 1471735978 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :1l \ 2l \ adjust \ asm \ axo \ bch \ befunge \ befunge98 \ bf \ bf16 \ bf32 \ bf8 \ bf_txtgen \ boolfuck \ c \ cintercal \ clcintercal \ cxx \ dimensifuck \ forth \ glass \ glypho \ haskell \ help \ java \ k \ kipple \ lambda \ lazyk \ linguine \ malbolge \ pbrain \ perl \ qbf \ rail \ rhotor \ sadol \ sceql \ sh \ slashes \ trigger \ udage01 \ und < 1471735989 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :hmm, we do < 1471735989 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :fungot: do you have a backdoor? < 1471735989 0 :fungot!~fungot@momus.zem.fi PRIVMSG #esoteric :int-e: it's time you jumped off this mortal coil... don't make a habit of this. here you are the only one thing we need to defeat you, lavos. < 1471735997 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :maybe my syntax was wrong, or maybe = isn't implemented < 1471736011 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :int-e: i think fungot didn't like the questino < 1471736011 0 :fungot!~fungot@momus.zem.fi PRIVMSG #esoteric :oerjan: it's time you jumped off this mortal coil... phew... thank you darling. < 1471736014 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :*on < 1471736026 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :fungot: you sound like a broken record < 1471736026 0 :fungot!~fungot@momus.zem.fi PRIVMSG #esoteric :FireFly: see? i like marle better than " princess,' the chosen time has come! he's strong and he's gonna thrash those monsters! yea! is it? < 1471736035 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :I see, CT < 1471736036 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :^style < 1471736036 0 :fungot!~fungot@momus.zem.fi PRIVMSG #esoteric :Available: agora alice c64 ct* darwin discworld enron europarl ff7 fisher fungot homestuck ic irc iwcs jargon lovecraft nethack oots pa qwantz sms speeches ss wp youtube < 1471736048 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :^style ct < 1471736048 0 :fungot!~fungot@momus.zem.fi PRIVMSG #esoteric :Selected style: ct (Chrono Trigger game script) < 1471736055 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :whatever < 1471736057 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`! befunge98 3y.@ < 1471736057 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :1128682830 < 1471736072 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`printf "%x" 1128682830 < 1471736072 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :​"0" 1128682830 < 1471736079 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`` printf "%x" 1128682830 < 1471736079 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :4346554e < 1471736097 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`` printf "\x4e\x55\x46\x43" < 1471736098 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :NUFC < 1471736101 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :cfunge, I guess < 1471736111 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :`` dc <<<1128682830P < 1471736112 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :CFUN < 1471736133 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :dc has a command for decoding Befunge handprint notation? < 1471736164 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :dc has a command for printing base 256 numbers as sequences of bytes < 1471736192 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :how convenient < 1471736223 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`! befunge98 <@.="echo Hello World" < 1471736243 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :it could be that there's some sort of sandboxing < 1471736245 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :IIRC cfunge had an option to avoid the use of dangerous commands like = < 1471736245 0 :int-e!~noone@static.88-198-179-137.clients.your-server.de PRIVMSG #esoteric :`` dc <<<28752pP | dc | dc < 1471736248 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :28752 \ pP < 1471736275 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`! befunge98 <@.2.="true".1 < 1471736284 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`! befunge98 <@.2.1 < 1471736291 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :1 2 < 1471736292 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :`file interps/befunge98 < 1471736294 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :interps/befunge98: ERROR: cannot open `interps/befunge98' (No such file or directory) < 1471736300 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`file ibin/befunge98 < 1471736300 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :`file interp/befunge98 < 1471736301 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :interp/befunge98: ERROR: cannot open `interp/befunge98' (No such file or directory) < 1471736301 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :ibin/befunge98: POSIX shell script, ASCII text executable < 1471736308 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`cat ibin/befunge98 < 1471736312 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :​#!/bin/sh \ . lib/interp \ interp_file "./interps/cfunge/cfunge -S" < 1471736326 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :ACTION looks up what -S does < 1471736355 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :-S Enable sandbox mode (see README for details). < 1471736369 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I can see a good argument for turning that off inside HackEgo < 1471736374 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :but I can also see a good argument for leaving it on < 1471736424 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :such as? < 1471736440 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :it seems a bit pointless to me < 1471736443 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :turning it off = because HackEgo has an outer sandbox < 1471736457 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :leaving it on = because people might not expect `! to have side effects < 1471736490 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :`! sh echo "they don't?" >test < 1471736504 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :now what. < 1471736511 0 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`file ibin/sh < 1471736548 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :ah, fair enough < 1471736556 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :`ls < 1471736602 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :HackEgo doesn't seem quite well < 1471736944 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :fizzie: HackEgo has some trouble < 1471736944 0 :HackEgo!~HackEgo@162.248.166.242 QUIT :Read error: Connection reset by peer < 1471736947 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :oh < 1471736957 0 :HackEgo!~HackEgo@162.248.166.242 JOIN :#esoteric < 1471736965 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :`echo hi < 1471736975 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :hi < 1471737001 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no PRIVMSG #esoteric :oh well, good night < 1471737007 0 :oerjan!~oerjan@hagbart.nvg.ntnu.no QUIT :Quit: ZZZ < 1471737104 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :`ls < 1471737105 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :advice \ bin \ canary \ candide \ cdescs \ emoticons \ esobible \ etc \ evil \ factor \ good \ hw \ ibin \ interps \ karma \ le \ lib \ ls \ misle \ out \ paste \ ply-3.8 \ ps \ quines \ quotes \ share \ src \ test \ theorems \ tmflry \ tmp \ wisdom \ wisdom.pdf < 1471737113 0 :FireFly!~firefly@freenode/staff/firefly PRIVMSG #esoteric :`cat test < 1471737113 0 :HackEgo!~HackEgo@162.248.166.242 PRIVMSG #esoteric :ho < 1471737294 0 :MoonyTheDwarf!~MoonyTheD@unaffiliated/moonythedwarf QUIT :Ping timeout: 260 seconds < 1471737567 0 :\oren\_!~oren@ec2-52-2-213-98.compute-1.amazonaws.com PRIVMSG #esoteric :I've arrived in Kelowna < 1471737595 0 :\oren\_!~oren@ec2-52-2-213-98.compute-1.amazonaws.com PRIVMSG #esoteric :@metar CYLW < 1471737595 0 :lambdabot!~lambdabot@haskell/bot/lambdabot PRIVMSG #esoteric :CYLW 202231Z AUTO 17004KT 120V200 6SM HZ CLR 32/07 A2980 RMK SLP084 DENSITY ALT 3800FT