Abuse filter log

Abuse Filter navigation (Home | Recent filter changes | Examine past edits | Abuse log)
Jump to navigation Jump to search
Details for log entry 7,403

20:32, 29 November 2019: RGSW (talk | contribs) triggered filter 9, performing the action "edit" on Genetic. Actions taken: Warn; Filter description: require new users to introduce themselves (examine)

Changes made in edit

  +
'''Genetic''' (a.k.a. ''DNA'') is an [[esoteric programming language]] that allows only the four DNA-bases (T, C, G and A), whitespaces and newlines (carriage return or line feed).
  +
  +
==Examples==
  +
===Hello world===
  +
ACTCAAGACCGTACTCGACCCCGTACTCGATACCGTACTCGATACCGTACTCGATTCCGTACTAGAAACCGTACTCCACTCCGTACTCGATTCCGTACTCTAAGCCGTACTCGATACCGTACTCGACACCGTACTAGAACCCGTACTAAAGGCCGT

Action parameters

VariableValue
Edit count of the user (user_editcount)
0
Name of the user account (user_name)
'RGSW'
Age of the user account (user_age)
526
Page ID (page_id)
0
Page namespace (page_namespace)
0
Page title (without namespace) (page_title)
'Genetic'
Full page title (page_prefixedtitle)
'Genetic'
Action (action)
'edit'
Edit summary/reason (summary)
''
Old content model (old_content_model)
''
New content model (new_content_model)
'wikitext'
Old page wikitext, before the edit (old_wikitext)
''
New page wikitext, after the edit (new_wikitext)
''''Genetic''' (a.k.a. ''DNA'') is an [[esoteric programming language]] that allows only the four DNA-bases (T, C, G and A), whitespaces and newlines (carriage return or line feed). ==Examples== ===Hello world=== ACTCAAGACCGTACTCGACCCCGTACTCGATACCGTACTCGATACCGTACTCGATTCCGTACTAGAAACCGTACTCCACTCCGTACTCGATTCCGTACTCTAAGCCGTACTCGATACCGTACTCGACACCGTACTAGAACCCGTACTAAAGGCCGT'
Unified diff of changes made by edit (edit_diff)
'@@ -1,0 +1,5 @@ +'''Genetic''' (a.k.a. ''DNA'') is an [[esoteric programming language]] that allows only the four DNA-bases (T, C, G and A), whitespaces and newlines (carriage return or line feed). + +==Examples== +===Hello world=== + ACTCAAGACCGTACTCGACCCCGTACTCGATACCGTACTCGATACCGTACTCGATTCCGTACTAGAAACCGTACTCCACTCCGTACTCGATTCCGTACTCTAAGCCGTACTCGATACCGTACTCGACACCGTACTAGAACCCGTACTAAAGGCCGT '
New page size (new_size)
370
Old page size (old_size)
0
Lines added in edit (added_lines)
[ 0 => ''''Genetic''' (a.k.a. ''DNA'') is an [[esoteric programming language]] that allows only the four DNA-bases (T, C, G and A), whitespaces and newlines (carriage return or line feed).', 1 => '', 2 => '==Examples==', 3 => '===Hello world===', 4 => ' ACTCAAGACCGTACTCGACCCCGTACTCGATACCGTACTCGATACCGTACTCGATTCCGTACTAGAAACCGTACTCCACTCCGTACTCGATTCCGTACTCTAAGCCGTACTCGATACCGTACTCGACACCGTACTAGAACCCGTACTAAAGGCCGT' ]
Unix timestamp of change (timestamp)
1575059575
Retrieved from "https://esolangs.org/wiki/Special:AbuseLog/7403"